RegulonDB RegulonDB 10.10:Regulon Page
   

MarA DNA-binding transcriptional dual regulator

Synonyms: MarA
Summary:
MarA, "multiple antibiotic resistance" [24], participates in controlling several genes involved in resistance to antibiotics [25] oxidative stress [26], organic solvents [26, 27, 28], and heavy metals [26]. The antibiotic resistance associated with MarA appears to involve the acidification of the cytoplasm [25]. MarA, SoxS, and Rob are paralogous transcriptional regulators that show 45% amino acid identity between them [24]; the crystal structures for Rob [29]| and MarA [30] confirm this similarity between them.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MarA Functional   nd nd
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: marA
  Genome position: 1619574-1619957
  Length: 384 bp / 127 aa
Operon name: marRAB
TU(s) encoding the TF:
Transcription unit        Promoter
marRAB
marRp


Regulon       
Regulated gene(s) acnA, acrA, acrB, acrZ, aldA, ariR, dctR, decR, fpr, fumC, hdeA, hdeB, inaA, lacA, lacY, lacZ, marA, marB, marR, micF, mlaB, mlaC, mlaD, mlaE, mlaF, nfo, nfsA, nfsB, poxB, pqiA, pqiB, pqiC, purA, putA, rimK, rob, slp, sodA, tolC, waaY, waaZ, xseA, ybjC, ybjN, ycgZ, ygiB, ygiC, yhiD, ymgA, ymgC, yncE, zwf
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (10)
drug resistance/sensitivity (7)
carbon compounds (6)
transport (6)
pH (5)
Read more >
Regulated operon(s) acrAB, acrZ, aldA, decR, fpr, fumAC, hcp-hcr-poxB-ltaE-ybjT, hdeAB-yhiD, inaA, lacZYA, marRAB, micF, mlaFEDCB, nfo, nfsB, pqiABC, purA, putA, rirA-waaQGPSBOJYZU, rob, slp-dctR, sodA, tolC-ygiBC, xseA, ybjC-nfsA-rimK-ybjN, ycgZ-ymgA-ariR-ymgC, ymiC-acnA, yncE, zwf
First gene in the operon(s) acnA, acrA, acrZ, aldA, decR, fpr, fumC, hdeA, inaA, lacZ, marR, micF, mlaF, nfo, nfsB, poxB, pqiA, purA, putA, waaY, rob, slp, sodA, tolC, xseA, ybjC, ycgZ, yncE, zwf
Simple and complex regulons AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS
AcrR,EnvR,MarA,MprA,PhoP,Rob,SoxS
AcrR,H-NS,HU,IHF,Lrp,MarA,OmpR,Rob,SoxS
ArcA,CRP,Cra,FNR,MarA,Rob,SoxS
ArcA,CRP,DnaA,FNR,MarA,Rob,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MarA,-](6)
[MarA,+](29)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MarA activator acnAp2 Sigma70 -51.5 -101.5 acnA
aaggtttctcCTCTTTTATCAATTTGGGTTGttatcaaatc
1335720 1335740 [GEA], [APIORCISFBSCS], [BPP], [CEEUMA], [IHBCE] [1]
  MarA activator acrAp Sigma70 -72.5 -151.5 acrA, acrB
ttgcgcttctTGTTTGGTTTTTCGTGCCATatgttcgtga
485761 485780 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [2], [3]
  MarA activator acrZp Sigma70 -40.5 -62.5 acrZ
cgcaaagctgACCGCACAAAAGGGGAGTGCttttctgtgc
794701 794720 [GEA], [IHBCE] [4]
  MarA activator aldAp Sigma70 -161.0 -203.0 aldA
gcgatggaaaGTCGCTCGTTACGTTAAAAAttgcccgttt
1488019 1488038 [GEA], [AIBSCS] [1]
  MarA activator decRp Sigma70 -65.0 -96.0 decR
tttttgcgttGAATTTGTCATTTTGTGCCGtggtgtttaa
468277 468296 [AIBSCS] [3]
  MarA activator fprp Sigma70 -58.5 -85.5 fpr
atcctctgatTGATTTGATCGATTGAGCCTtccagtcctt
4114548 4114567 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [5]
  MarA activator fumCp2 Sigma38 -46.5 -167.5 fumC
ttccagcagaTACAACTCACACAATGCACCcgctgtgtga
1686746 1686765 [GEA], [BPP] [5], [6]
  MarA repressor hdeAp Sigma70 -39.0 -90.0 hdeA, hdeB, yhiD
tgattttgatATTTTCCATCAACATGACATatacagaaaa
3656820 3656839 [APPH], [GEA], [APIORCISFBSCS], [APPH], [SM] [7]
  MarA repressor hdeAp2 Sigma38 -39.0 -90.0 hdeA, hdeB, yhiD
tgattttgatATTTTCCATCAACATGACATatacagaaaa
3656820 3656839 [APPH], [GEA], [APIORCISFBSCS], [APPH], [SM] [7]
  MarA activator inaAp Sigma70 -41.5 -68.5 inaA
attcattaatACGACACGTTTCATTAAGATtttcctcagg
2349531 2349550 [GEA], [APIORCISFBSCS], [BPP] [2], [6], [8]
  MarA repressor lacZp1 Sigma70 -30.0 -68.0 lacZ, lacY, lacA
ggcaccccagGCTTTACACTTTATGCttccggctcg
366366 366381 [GEA], [BPP], [SM] [9]
  MarA activator marRp Sigma70 -61.5 -88.5 marR, marA, marB
acttgaaccgATTTAGCAAAACGTGGCATCggtcaattca
1619022 1619041 [GEA], [APIORCISFBSCS], [BPP], [SM] [2], [5], [6], [10], [11]
  MarA activator micFp1 Sigma70 -40.0 -40.0 micF
aagtatttgaCAGCACTGAATGTCAAAACAaaaccttcac
2313034 2313053 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [5], [12]
  MarA activator micFp2 Sigma38 -40.0 -40.0 micF
aagtatttgaCAGCACTGAATGTCAAAACAaaaccttcac
2313034 2313053 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [5], [12]
  MarA activator mlaFp2 nd -41.5 -97.5 mlaF, mlaE, mlaD, mlaC, mlaB
taaaacaaatGCCAGCTTTCGCTAACcacggcgggt
3340155 3340170 [GEA], [BPP], [ICWHO] [13]
  MarA activator nfop Sigma70 -38.5 -72.5 nfo
tcaaagcgtcATCGCATAAACCACTACATCttgctcctgt
2250758 2250777 [GEA], [APIORCISFBSCS] [2], [14]
  MarA activator nfsBp Sigma70 -43.5 -72.5 nfsB
gcggaaatctATAGCGCATTTTTCTCGCTTaccatttctc
605487 605506 [GEA], [APIORCISFBSCS], [BPP] [1], [15]
  MarA activator poxBp1 Sigma70 -60.5 -87.5 poxB
ttcatcgggcTATTTAACCGTTAGTGCCTCctttctctcc
911127 911146 [GEA], [APIORCISFBSCS] [2]
  MarA activator poxBp2 Sigma38 -60.5 -87.5 poxB
ttcatcgggcTATTTAACCGTTAGTGCCTCctttctctcc
911127 911146 [GEA], [APIORCISFBSCS] [2]
  MarA activator pqiAp1 Sigma70 -42.5 -377.5 pqiA, pqiB, pqiC
cgccgcggcaAAAGCAGAAACTGTAAAACGcagcagtagc
1011614 1011633 [GEA], [APIORCISFBSCS], [BPP] [2], [8]
  MarA activator pqiAp3 Sigma38 -42.5 -377.5 pqiA, pqiB, pqiC
cgccgcggcaAAAGCAGAAACTGTAAAACGcagcagtagc
1011614 1011633 [GEA], [APIORCISFBSCS], [BPP] [2], [8]
  MarA repressor purAp Sigma70 -43.0 -66.0 purA
cgaggtcattTTTGAGTGCAAAAAGTGCTGtaactctgaa
4404611 4404630 [GEA], [APIORCISFBSCS], [BPP], [SM] [7]
  MarA activator putAp Sigma70 nd nd putA nd nd [GEA], [BPP] [6]
  MarA repressor robp nd -20.0 -63.0 rob
actgaatgctAAAACAGCAAAAAATGCTATtatccaatta
4635363 4635382 [GEA], [APIORCISFBSCS], [BPP], [SM] [16]
  MarA repressor slpp Sigma70 39.0 14.0 slp, dctR
tagtaacatgAACATGACAAAAGGTGCACTcatcctcagc
3653964 3653983 [GEA], [APIORCISFBSCS] [17], [18]
  MarA activator sodAp Sigma70 -40.5 -91.5 sodA
tacgaaaagtACGGCATTGATAATCATTTTcaatatcatt
4100709 4100728 [APIORCISFBSCS] [2], [8], [14]
  MarA activator tolCp3 nd -40.5 -93.5 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTtttgcggtag
3178012 3178031 [AIBSCS], [GEA], [AIBSCS] [3], [19], [20]
  MarA activator tolCp4 Sigma38 -52.5 -93.5 tolC, ygiB, ygiC
ttaacgccctATGGCACGTAACGCCAACCTtttgcggtag
3178012 3178031 [GEA], [AIBSCS] [3], [19], [20]
  MarA activator waaYp Sigma70 -43.0 -214.0 waaY, waaZ
gcaactaaacCGTGGCACAAATGGGCAATTtatccatcgg
3801169 3801188 [GEA], [APIORCISFBSCS] [21]
  MarA activator xseAp Sigma70 -42.0 -77.0 xseA
atctacccctTTTTGCAAAAAATGCTtgctatcccc
2634148 2634163 [GEA], [BPP], [ICWHO] [13]
  MarA activator ybjCp Sigma70 -40.5 -61.5 ybjC, nfsA, rimK, ybjN
ttaattgctaAAAGCTATAACTGTTAAACAcaatacagtg
890842 890861 [GEA], [AIBSCS], [APIORCISFBSCS], [CEEUMA], [RSE] [1], [8]
  MarA activator ycgZp Sigma70 -62.0 -99.0 ycgZ, ymgA, ariR, ymgC
atatgcattaGCACTAATTGCAAAAAattaatttat
1215683 1215698 [AIBSCS], [BPP], [CSE], [SM] [22]
  MarA activator ycgZp2 Sigma38 -62.0 -99.0 ycgZ, ymgA, ariR, ymgC
atatgcattaGCACTAATTGCAAAAAattaatttat
1215683 1215698 [AIBSCS], [BPP], [CSE], [SM] [22]
  MarA activator yncEp nd -41.5 -121.5 yncE
tgtagtcgtaACGGCAAGAAATGCTCCACATttgagaaaat
1523176 1523196 [GEA], [APIORCISFBSCS] [1]
  MarA activator zwfp Sigma70 -54.0 -116.0 zwf
gcttttcccgTAATCGCACGGGTGGATAAGcgtttacagt
1936420 1936439 [GEA], [APIORCISFBSCS], [BPP] [2], [5], [14], [23]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  MarA activator mdaB Transcription-Unit -68.0
cgcaaaagacTTTGCACATTTTGCTAATTTcaccgtaccg
3172452 3172471 3172462.0 nd [GEA], [AIBSCS] [1]
  MarA activator yhbW Transcription-Unit -66.0
gcctaagtaaATAGCTCACTTTGTTAACAActttaactac
3303372 3303391 3303382.0 nd [GEA], [AIBSCS] [1]
  MarA activator map-glnD-dapD Transcription-Unit nd
aatcattctgAATTTCGCCAAACGTGCCACtgaaggtttt
189597 189616 189607.0 nd [GEA], [AIBSCS] [1]


Alignment and PSSM for MarA TFBSs    

Aligned TFBS of MarA   
  Sequence
  CACCACGGCACAAAATGACAAAT
  CCCTATGGCACGTAACGCCAACC
  ACATATGGCACGAAAAACCAAAC
  CGTAACGGCAAGAAATGCTCCAC
  AAAGGAGGCACTAACGGTTAAAT
  TTTGACAGCACTGAATGTCAAAA
  AACCGTGGCACAAATGGGCAATT
  GCTAAAAGCTATAACTGTTAAAC
  GCTGACCGCACAAAAGGGGAGTG
  TAAAACAGCAAAAAATGCTATTA
  CTGGAAGGCTCAATCGATCAAAT
  ACCGATGCCACGTTTTGCTAAAT
  GGCAAAAGCAGAAACTGTAAAAC
  CGTCATCGCATAAACCACTACAT
  CGTAATCGCACGGGTGGATAAGC
  GAAAGTCGCTCGTTACGTTAAAA
  ATGAACATGACAAAAGGTGCACT
  AGTTACAGCACTTTTTGCACTCA
  CCTTTTTGCAAAAAATGCTTGCT
  AAGTACGGCATTGATAATCATTT
  GGTAAGCGAGAAAAATGCGCTAT
  GTGGTTAGCGAAAGCTGGCATTT
  TAATACGACACGTTTCATTAAGA
  AGATACAACTCACACAATGCACC
  CCCAAATTGATAAAAGAGGAGAA
  TATTTTCCATCAACATGACATAT

Position weight matrix (PWM). MarA matrix-quality result   
A	8	8	6	9	20	5	8	2	2	19	6	14	17	18	13	3	7	3	2	20	15	14	6
C	8	7	6	3	0	10	6	2	22	0	16	0	1	1	7	4	0	9	9	5	2	5	7
G	6	7	4	6	3	1	10	20	2	2	1	7	3	2	0	7	19	4	5	0	3	2	1
T	4	4	10	8	3	10	2	2	0	5	3	5	5	5	6	12	0	10	10	1	6	5	12

Consensus   
;	consensus.strict             	cgtaacgGCaCaaaatGccaaat
;	consensus.strict.rc          	ATTTGGCATTTTGTGCCGTTACG
;	consensus.IUPAC              	vvydayvGCaCraamkGyyaaay
;	consensus.IUPAC.rc           	RTTTRRCMKTTYGTGCBRTHRBB
;	consensus.regexp             	[acg][acg][ct][agt]a[ct][acg]GCaC[ag]aa[ac][gt]G[ct][ct]aaa[ct]
;	consensus.regexp.rc          	[AG]TTT[AG][AG]C[AC][GT]TT[CT]GTGC[CGT][AG]T[ACT][AG][CGT][CGT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] Martin RG., Rosner JL., 2002, Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data., Mol Microbiol 44(6):1611-24

 [2] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [3] Rodionov DA., Gelfand MS., Mironov AA., Rakhmaninova AB., 2001, Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria., J Mol Microbiol Biotechnol 3(2):319-24

 [4] Hobbs EC., Yin X., Paul BJ., Astarita JL., Storz G., 2012, Conserved small protein associates with the multidrug efflux pump AcrB and differentially affects antibiotic resistance., Proc Natl Acad Sci U S A 109(41):16696-701

 [5] Gillette WK., Martin RG., Rosner JL., 2000, Probing the Escherichia coli transcriptional activator MarA using alanine-scanning mutagenesis: residues important for DNA binding and activation., J Mol Biol 299(5):1245-55

 [6] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [7] Schneiders T., Barbosa TM., McMurry LM., Levy SB., 2004, The Escherichia coli transcriptional regulator MarA directly represses transcription of purA and hdeA., J Biol Chem 279(10):9037-42

 [8] Martin RG., Rosner JL., 2011, Promoter discrimination at class I MarA regulon promoters mediated by glutamic acid 89 of the MarA transcriptional activator of Escherichia coli., J Bacteriol 193(2):506-15

 [9] Lankester A., Ahmed S., Lamberte LE., Kettles RA., Grainger DC., 2019, The Escherichia coli multiple antibiotic resistance activator protein represses transcription of the lac operon., Biochem Soc Trans 47(2):671-677

 [10] Belliveau NM., Barnes SL., Ireland WT., Jones DL., Sweredoski MJ., Moradian A., Hess S., Kinney JB., Phillips R., 2018, Systematic approach for dissecting the molecular mechanisms of transcriptional regulation in bacteria., Proc Natl Acad Sci U S A 115(21):E4796-E4805

 [11] Martin RG., Jair KW., Wolf RE., Rosner JL., 1996, Autoactivation of the marRAB multiple antibiotic resistance operon by the MarA transcriptional activator in Escherichia coli., J Bacteriol 178(8):2216-23

 [12] Delihas N., Forst S., 2001, MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors., J Mol Biol 313(1):1-12

 [13] Sharma P., Haycocks JRJ., Middlemiss AD., Kettles RA., Sellars LE., Ricci V., Piddock LJV., Grainger DC., 2017, The multiple antibiotic resistance operon of enteric bacteria controls DNA repair and outer membrane integrity., Nat Commun 8(1):1444

 [14] Jair KW., Martin RG., Rosner JL., Fujita N., Ishihama A., Wolf RE., 1995, Purification and regulatory properties of MarA protein, a transcriptional activator of Escherichia coli multiple antibiotic and superoxide resistance promoters., J Bacteriol 177(24):7100-4

 [15] Barbosa TM., Levy SB., 2002, Activation of the Escherichia coli nfnB gene by MarA through a highly divergent marbox in a class II promoter., Mol Microbiol 45(1):191-202

 [16] Schneiders T., Levy SB., 2006, MarA-mediated transcriptional repression of the rob promoter., J Biol Chem 281(15):10049-55

 [17] Price GP., St John AC., 2000, Purification and analysis of expression of the stationary phase-inducible slp lipoprotein in Escherichia coli: role of the Mar system., FEMS Microbiol Lett 193(1):51-6

 [18] Seoane AS., Levy SB., 1995, Identification of new genes regulated by the marRAB operon in Escherichia coli., J Bacteriol 177(3):530-5

 [19] Aono R., Tsukagoshi N., Yamamoto M., 1998, Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12., J Bacteriol 180(4):938-44

 [20] Zhang A., Rosner JL., Martin RG., 2008, Transcriptional activation by MarA, SoxS and Rob of two tolC promoters using one binding site: a complex promoter configuration for tolC in Escherichia coli., Mol Microbiol 69(6):1450-5

 [21] Lee JH., Lee KL., Yeo WS., Park SJ., Roe JH., 2009, SoxRS-mediated lipopolysaccharide modification enhances resistance against multiple drugs in Escherichia coli., J Bacteriol 191(13):4441-50

 [22] Kettles RA., Tschowri N., Lyons KJ., Sharma P., Hengge R., Webber MA., Grainger DC., 2019, The Escherichia coli MarA protein regulates the ycgZ-ymgABC operon to inhibit biofilm formation., Mol Microbiol 112(5):1609-1625

 [23] Jair KW., Yu X., Skarstad K., Thony B., Fujita N., Ishihama A., Wolf RE., 1996, Transcriptional activation of promoters of the superoxide and multiple antibiotic resistance regulons by Rob, a binding protein of the Escherichia coli origin of chromosomal replication., J Bacteriol 178(9):2507-13

 [24] Cohen SP., Hachler H., Levy SB., 1993, Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli., J Bacteriol 175(5):1484-92

 [25] Reyes-Fernández EZ, Schuldiner S, 2020, Acidification of Cytoplasm in Escherichia coli Provides a Strategy to Cope with Stress and Facilitates Development of Antibiotic Resistance., Sci Rep, 10(1):9954 10.1038/s41598-020-66890-1

 [26] Alekshun MN, Levy SB, 1999, The mar regulon: multiple resistance to antibiotics and other toxic chemicals., Trends Microbiol, 7(10):410 10.1016/s0966-842x(99)01589-9

 [27] White DG, Goldman JD, Demple B, Levy SB, 1997, Role of the acrAB locus in organic solvent tolerance mediated by expression of marA, soxS, or robA in Escherichia coli., J Bacteriol, 179(19):6122 10.1128/jb.179.19.6122-6126.1997

 [28] Asako H, Nakajima H, Kobayashi K, Kobayashi M, Aono R, 1997, Organic solvent tolerance and antibiotic resistance increased by overexpression of marA in Escherichia coli., Appl Environ Microbiol, 63(4):1428 10.1128/aem.63.4.1428-1433.1997

 [29] Kwon HJ., Bennik MH., Demple B., Ellenberger T., 2000, Crystal structure of the Escherichia coli Rob transcription factor in complex with DNA., Nat Struct Biol 7(5):424-30

 [30] Rhee S, Martin RG, Rosner JL, Davies DR, 1998, A novel DNA-binding motif in MarA: the first structure for an AraC family transcriptional activator., Proc Natl Acad Sci U S A, 95(18):10413 10.1073/pnas.95.18.10413

 [31] Rosner JL, Dangi B, Gronenborn AM, Martin RG, 2002, Posttranscriptional activation of the transcriptional activator Rob by dipyridyl in Escherichia coli., J Bacteriol, 184(5):1407 10.1128/JB.184.5.1407-1416.2002

 [32] Rosenberg EY., Bertenthal D., Nilles ML., Bertrand KP., Nikaido H., 2003, Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein., Mol Microbiol 48(6):1609-19

 [33] Martin RG, Gillette WK, Martin NI, Rosner JL, 2002, Complex formation between activator and RNA polymerase as the basis for transcriptional activation by MarA and SoxS in Escherichia coli., Mol Microbiol, 43(2):355 10.1046/j.1365-2958.2002.02748.x

 [34] Wang T, Kunze C, Dunlop MJ, 2019, Salicylate Increases Fitness Cost Associated with MarA-Mediated Antibiotic Resistance., Biophys J, 117(3):563 10.1016/j.bpj.2019.07.005

 [35] Demple B, 1996, Redox signaling and gene control in the Escherichia coli soxRS oxidative stress regulon--a review., Gene, 179(1):53 10.1016/s0378-1119(96)00329-0

 [36] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [37] Wood TI., Griffith KL., Fawcett WP., Jair KW., Schneider TD., Wolf RE., 1999, Interdependence of the position and orientation of SoxS binding sites in the transcriptional activation of the class I subset of Escherichia coli superoxide-inducible promoters., Mol Microbiol 34(3):414-30

 [38] Martin RG, Bartlett ES, Rosner JL, Wall ME, 2008, Activation of the Escherichia coli marA/soxS/rob regulon in response to transcriptional activator concentration., J Mol Biol, 380(2):278 10.1016/j.jmb.2008.05.015

 [39] Wall ME, Markowitz DA, Rosner JL, Martin RG, 2009, Model of transcriptional activation by MarA in Escherichia coli., PLoS Comput Biol, 5(12):e1000614 10.1371/journal.pcbi.1000614

 [40] Dangi B., Pelupessey P., Martin RG., Rosner JL., Louis JM., Gronenborn AM., 2001, Structure and dynamics of MarA-DNA complexes: an NMR investigation., J Mol Biol 314(1):113-27

 [41] Griffith KL., Wolf RE., 2001, Systematic mutagenesis of the DNA binding sites for SoxS in the Escherichia coli zwf and fpr promoters: identifying nucleotides required for DNA binding and transcription activation., Mol Microbiol 40(5):1141-54

 [42] Griffith KL, Shah IM, Myers TE, O'Neill MC, Wolf RE, 2002, Evidence for "pre-recruitment" as a new mechanism of transcription activation in Escherichia coli: the large excess of SoxS binding sites per cell relative to the number of SoxS molecules per cell., Biochem Biophys Res Commun, 291(4):979 10.1006/bbrc.2002.6559

 [43] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [44] Griffith KL, Wolf RE, 2002, A comprehensive alanine scanning mutagenesis of the Escherichia coli transcriptional activator SoxS: identifying amino acids important for DNA binding and transcription activation., J Mol Biol, 322(2):237 10.1016/s0022-2836(02)00782-9

 [45] Koulechova DA, Tripp KW, Horner G, Marqusee S, 2015, When the Scaffold Cannot Be Ignored: The Role of the Hydrophobic Core in Ligand Binding and Specificity., J Mol Biol, 427(20):3316 10.1016/j.jmb.2015.08.014

 [46] Griffith KL, Shah IM, Wolf RE, 2004, Proteolytic degradation of Escherichia coli transcription activators SoxS and MarA as the mechanism for reversing the induction of the superoxide (SoxRS) and multiple antibiotic resistance (Mar) regulons., Mol Microbiol, 51(6):1801 10.1046/j.1365-2958.2003.03952.x

 [47] Shah IM, Wolf RE, 2006, Inhibition of Lon-dependent degradation of the Escherichia coli transcription activator SoxS by interaction with 'soxbox' DNA or RNA polymerase., Mol Microbiol, 60(1):199 10.1111/j.1365-2958.2006.05086.x

 [48] Bhaskarla C, Das M, Verma T, Kumar A, Mahadevan S, Nandi D, 2016, Roles of Lon protease and its substrate MarA during sodium salicylate-mediated growth reduction and antibiotic resistance in Escherichia coli., Microbiology (Reading), 162(5):764 10.1099/mic.0.000271

 [49] Rodrigo G, Bajic D, Elola I, Poyatos JF, 2016, Antagonistic autoregulation speeds up a homogeneous response in Escherichia coli., Sci Rep, 6(None):36196 10.1038/srep36196

 [50] Shultzaberger RK, Maerkl SJ, Kirsch JF, Eisen MB, 2012, Probing the informational and regulatory plasticity of a transcription factor DNA-binding domain., PLoS Genet, 8(3):e1002614 10.1371/journal.pgen.1002614

 [51] Rossi NA, Dunlop MJ, 2017, Customized Regulation of Diverse Stress Response Genes by the Multiple Antibiotic Resistance Activator MarA., PLoS Comput Biol, 13(1):e1005310 10.1371/journal.pcbi.1005310

 [52] Lin H, Ye C, Chen S, Zhang S, Yu X, 2017, Viable but non-culturable E. coli induced by low level chlorination have higher persistence to antibiotics than their culturable counterparts., Environ Pollut, 230(None):242 10.1016/j.envpol.2017.06.047

 [53] Rossi NA, Mora T, Walczak AM, Dunlop MJ, 2018, Active degradation of MarA controls coordination of its downstream targets., PLoS Comput Biol, 14(12):e1006634 10.1371/journal.pcbi.1006634

 [54] Praski Alzrigat L, Huseby DL, Brandis G, Hughes D, 2021, Resistance/fitness trade-off is a barrier to the evolution of MarR inactivation mutants in Escherichia coli., J Antimicrob Chemother, 76(1):77 10.1093/jac/dkaa417

 [55] Machas M., Kurgan G., Abed OA., Shapiro A., Wang X., Nielsen D., 2021, Characterizing Escherichia coli's transcriptional response to different styrene exposure modes reveals novel toxicity and tolerance insights., J Ind Microbiol Biotechnol

 [56] Randall LP, Woodward MJ, 2002, The multiple antibiotic resistance (mar) locus and its significance., Res Vet Sci, 72(2):87 10.1053/rvsc.2001.0537



RegulonDB