RegulonDB RegulonDB 10.8:Regulon Page

MarA DNA-binding transcriptional dual regulator

Synonyms: MarA
MarA, "multiple antibiotic resistance" [2], participates in controlling several genes involved in resistance to antibiotics, oxidative stress [], organic solvents [], and heavy metals []. MarA, SoxS, and Rob are paralogous transcriptional regulators that show 45% amino acid identity between them [2]; the crystal structures for Rob [19]| and MarA [] confirm this similarity between them. They activate a common set of genes, but the expression and activity of each one of these proteins are induced by different signals: the activity of Rob is increased with dipyridyl, bile salts, or decanoate [30], and the transcription of MarA and SoxS is increased by the aromatic weak acid salicylate [] and oxidative stress [], respectively. Many genes are regulated by all three proteins; however, some genes are regulated only by one of them.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MarA Functional   [IE] [1], [2], [3], [4], [5], [6]
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: marA
  Genome position: 1619574-1619957
  Length: 384 bp / 127 aa
Operon name: marRAB
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) acnA, acrA, acrB, acrZ, aldA, ariR, dctR, decR, fpr, fumC, hdeA, hdeB, inaA, lacA, lacY, lacZ, marA, marB, marR, micF, mlaB, mlaC, mlaD, mlaE, mlaF, nfo, nfsA, nfsB, poxB, pqiA, pqiB, pqiC, purA, putA, rimK, rob, slp, sodA, tolC, waaY, waaZ, xseA, ybjC, ybjN, ycgZ, ygiB, ygiC, yhiD, ymgA, ymgC, yncE, zwf
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (10)
drug resistance/sensitivity (7)
carbon compounds (6)
transport (6)
pH (5)
Read more >
Regulated operon(s) acrAB, acrZ, aldA, decR, fpr, fumAC, hcp-hcr-poxB-ltaE-ybjT, hdeAB-yhiD, inaA, lacZYA, marRAB, micF, mlaFEDCB, nfo, nfsB, pqiABC, purA, putA, rirA-waaQGPSBOJYZU, rob, slp-dctR, sodA, tolC-ygiBC, xseA, ybjC-nfsA-rimK-ybjN, ycgZ-ymgA-ariR-ymgC, ymiC-acnA, yncE, zwf
First gene in the operon(s) acnA, acrA, acrZ, aldA, decR, fpr, fumC, hdeA, inaA, lacZ, marR, micF, mlaF, nfo, nfsB, poxB, pqiA, purA, putA, waaY, rob, slp, sodA, tolC, xseA, ybjC, ycgZ, yncE, zwf
Simple and complex regulons AcrR,CRP,CpxR,Cra,Fis,MarA,MarR,Rob,SoxS
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MarA activator acnAp2 Sigma70 -51.5 -101.5 acnA
1335720 1335740 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [7], [8]
  MarA activator acrAp Sigma70 -72.5 -151.5 acrA, acrB
485761 485780 [AIBSCS], [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [8], [9], [10]
  MarA activator acrZp Sigma70 -40.5 -62.5 acrZ
794701 794720 [CV(GEA/ROMA)], [GEA], [IHBCE] [11]
  MarA activator aldAp Sigma70 -161.0 -203.0 aldA
1488019 1488038 [AIBSCS], [CV(GEA/ROMA)], [GEA] [7]
  MarA activator decRp Sigma70 -65.0 -96.0 decR
468277 468296 [AIBSCS] [10]
  MarA activator fprp Sigma70 -58.5 -85.5 fpr
4114548 4114567 [AIBSCS], [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [8], [10], [12]
  MarA activator fumCp Sigma38 -46.5 -167.5 fumC
1686746 1686765 [BPP], [GEA] [12], [13]
  MarA repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -39.0 -90.0 hdeA, hdeB, yhiD
3656820 3656839 [APIORCISFBSCS], [APPH], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [SM] [14]
  MarA activator inaAp Sigma70 -41.5 -68.5 inaA
2349531 2349550 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [8], [9], [13]
  MarA repressor lacZp1 Sigma70 -30.0 -68.0 lacZ, lacY, lacA
366366 366381 [BPP], [CV(CHIP-SV/SM)], [GEA], [SM] [15]
  MarA activator marRp Sigma70 -61.5 -88.5 marR, marA, marB
1619022 1619041 [AIBSCS], [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [SM] [8], [9], [10], [12], [13], [16], [17]
  MarA activator micFp Sigma38, Sigma70 -40.0 -40.0 micF
2313034 2313053 [AIBSCS], [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [10], [12], [18], [19]
  MarA activator mlaFp2 nd -41.5 -97.5 mlaF, mlaE, mlaD, mlaC, mlaB
3340155 3340170 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [ICWHO] [20]
  MarA activator nfop Sigma70 -38.5 -72.5 nfo
2250758 2250777 [AIBSCS], [APIORCISFBSCS], [CV(GEA/ROMA)], [GEA] [4], [9], [10]
  MarA activator nfsBp Sigma70 -43.5 -72.5 nfsB
605487 605507 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [7], [21]
  MarA activator poxBp Sigma38, Sigma70 -60.5 -87.5 poxB
911127 911146 [APIORCISFBSCS], [CV(GEA/ROMA)], [GEA] [9]
  MarA activator pqiAp1 Sigma70, Sigma38 -42.5 -377.5 pqiA, pqiB, pqiC
1011614 1011633 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [8], [9]
  MarA repressor purAp Sigma70 -43.0 -66.0 purA
4404611 4404630 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [SM] [14]
  MarA activator putAp Sigma70 nd nd putA nd nd [GEA] [13]
  MarA repressor robp nd -20.0 -62.5 rob
4635363 4635382 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [SM] [22]
  MarA repressor slpp Sigma70 39.0 14.0 slp, dctR
3653964 3653983 [APIORCISFBSCS], [CV(GEA/ROMA)], [GEA] [23], [24]
  MarA activator sodAp Sigma70 -40.5 -91.5 sodA
4100709 4100728 [APIORCISFBSCS], [BPP] [4], [8], [9]
  MarA activator tolCp3 nd -40.5 -93.5 tolC, ygiB, ygiC
3178012 3178032 [AIBSCS], [CV(GEA/ROMA)], [GEA] [10], [25], [26]
  MarA activator tolCp4 Sigma38 -52.5 -93.5 tolC, ygiB, ygiC
3178012 3178032 [AIBSCS], [CV(GEA/ROMA)], [GEA] [10], [25], [26]
  MarA activator waaYp Sigma70 -43.0 -214.0 waaY, waaZ
3801169 3801188 [APIORCISFBSCS], [CV(GEA/ROMA)], [GEA] [27]
  MarA activator xseAp Sigma70 -42.0 -77.0 xseA
2634148 2634163 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [ICWHO] [20]
  MarA activator ybjCp Sigma70 -40.5 -61.5 ybjC, nfsA, rimK, ybjN
890842 890861 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [7], [8]
  MarA activator ycgZp Sigma38, Sigma70 -62.0 -99.0 ycgZ, ymgA, ariR, ymgC
1215683 1215698 [AIBSCS], [BPP], , [CV(CHIP-SV/SM)], [SM] [28]
  MarA activator yncEp nd -41.5 -121.5 yncE
1523176 1523196 [APIORCISFBSCS], [CV(GEA/ROMA)], [GEA] [7]
  MarA activator zwfp Sigma70 -54.0 -116.0 zwf
1936420 1936439 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [4], [8], [9], [12], [29]

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  MarA activator nd tu nd
189597 189616 189607.0 nd [AIBSCS], [GEA] [7]
  MarA activator nd tu nd
3172452 3172471 3172462.0 nd [AIBSCS], [GEA] [7]
  MarA activator nd tu nd
3303372 3303391 3303382.0 nd [AIBSCS], [GEA] [7]

Alignment and PSSM for MarA TFBSs    

Aligned TFBS of MarA   

Position weight matrix (PWM). MarA matrix-quality result   
A	8	8	6	9	20	5	8	2	2	19	6	14	17	18	13	3	7	3	2	20	15	14	6
C	8	7	6	3	0	10	6	2	22	0	16	0	1	1	7	4	0	9	9	5	2	5	7
G	6	7	4	6	3	1	10	20	2	2	1	7	3	2	0	7	19	4	5	0	3	2	1
T	4	4	10	8	3	10	2	2	0	5	3	5	5	5	6	12	0	10	10	1	6	5	12

;	consensus.strict             	cgtaacgGCaCaaaatGccaaat
;	consensus.strict.rc          	ATTTGGCATTTTGTGCCGTTACG
;	consensus.IUPAC              	vvydayvGCaCraamkGyyaaay
;	consensus.regexp             	[acg][acg][ct][agt]a[ct][acg]GCaC[ag]aa[ac][gt]G[ct][ct]aaa[ct]
;	consensus.regexp.rc          	[AG]TTT[AG][AG]C[AC][GT]TT[CT]GTGC[CGT][AG]T[ACT][AG][CGT][CGT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Alon Cudkowicz N., Schuldiner S., 2019, Deletion of the major Escherichia coli multidrug transporter AcrB reveals transporter plasticity and redundancy in bacterial cells., PLoS One 14(6):e0218828

 [2] Cohen SP., Hachler H., Levy SB., 1993, Genetic and functional analysis of the multiple antibiotic resistance (mar) locus in Escherichia coli., J Bacteriol 175(5):1484-92

 [3] Gambino L., Gracheck SJ., Miller PF., 1993, Overexpression of the MarA positive regulator is sufficient to confer multiple antibiotic resistance in Escherichia coli., J Bacteriol 175(10):2888-94

 [4] Jair KW., Martin RG., Rosner JL., Fujita N., Ishihama A., Wolf RE., 1995, Purification and regulatory properties of MarA protein, a transcriptional activator of Escherichia coli multiple antibiotic and superoxide resistance promoters., J Bacteriol 177(24):7100-4

 [5] Jindal S., Yang L., Day PJ., Kell DB., 2019, Involvement of multiple influx and efflux transporters in the accumulation of cationic fluorescent dyes by Escherichia coli., BMC Microbiol 19(1):195

 [6] Pu Y., Zhao Z., Li Y., Zou J., Ma Q., Zhao Y., Ke Y., Zhu Y., Chen H., Baker MAB., Ge H., Sun Y., Xie XS., Bai F., 2016, Enhanced Efflux Activity Facilitates Drug Tolerance in Dormant Bacterial Cells., Mol Cell 62(2):284-294

 [7] Martin RG., Rosner JL., 2002, Genomics of the marA/soxS/rob regulon of Escherichia coli: identification of directly activated promoters by application of molecular genetics and informatics to microarray data., Mol Microbiol 44(6):1611-24

 [8] Martin RG., Rosner JL., 2011, Promoter discrimination at class I MarA regulon promoters mediated by glutamic acid 89 of the MarA transcriptional activator of Escherichia coli., J Bacteriol 193(2):506-15

 [9] Martin RG., Gillette WK., Rhee S., Rosner JL., 1999, Structural requirements for marbox function in transcriptional activation of mar/sox/rob regulon promoters in Escherichia coli: sequence, orientation and spatial relationship to the core promoter., Mol Microbiol 34(3):431-41

 [10] Rodionov DA., Gelfand MS., Mironov AA., Rakhmaninova AB., 2001, Comparative approach to analysis of regulation in complete genomes: multidrug resistance systems in gamma-proteobacteria., J Mol Microbiol Biotechnol 3(2):319-24

 [11] Hobbs EC., Yin X., Paul BJ., Astarita JL., Storz G., 2012, Conserved small protein associates with the multidrug efflux pump AcrB and differentially affects antibiotic resistance., Proc Natl Acad Sci U S A 109(41):16696-701

 [12] Gillette WK., Martin RG., Rosner JL., 2000, Probing the Escherichia coli transcriptional activator MarA using alanine-scanning mutagenesis: residues important for DNA binding and activation., J Mol Biol 299(5):1245-55

 [13] Pomposiello PJ., Bennik MH., Demple B., 2001, Genome-wide transcriptional profiling of the Escherichia coli responses to superoxide stress and sodium salicylate., J Bacteriol 183(13):3890-902

 [14] Schneiders T., Barbosa TM., McMurry LM., Levy SB., 2004, The Escherichia coli transcriptional regulator MarA directly represses transcription of purA and hdeA., J Biol Chem 279(10):9037-42

 [15] Lankester A., Ahmed S., Lamberte LE., Kettles RA., Grainger DC., 2019, The Escherichia coli multiple antibiotic resistance activator protein represses transcription of the lac operon., Biochem Soc Trans 47(2):671-677

 [16] Belliveau NM., Barnes SL., Ireland WT., Jones DL., Sweredoski MJ., Moradian A., Hess S., Kinney JB., Phillips R., 2018, Systematic approach for dissecting the molecular mechanisms of transcriptional regulation in bacteria., Proc Natl Acad Sci U S A 115(21):E4796-E4805

 [17] Martin RG., Jair KW., Wolf RE., Rosner JL., 1996, Autoactivation of the marRAB multiple antibiotic resistance operon by the MarA transcriptional activator in Escherichia coli., J Bacteriol 178(8):2216-23

 [18] Delihas N., Forst S., 2001, MicF: an antisense RNA gene involved in response of Escherichia coli to global stress factors., J Mol Biol 313(1):1-12

 [19] Kwon HJ., Bennik MH., Demple B., Ellenberger T., 2000, Crystal structure of the Escherichia coli Rob transcription factor in complex with DNA., Nat Struct Biol 7(5):424-30

 [20] Sharma P., Haycocks JRJ., Middlemiss AD., Kettles RA., Sellars LE., Ricci V., Piddock LJV., Grainger DC., 2017, The multiple antibiotic resistance operon of enteric bacteria controls DNA repair and outer membrane integrity., Nat Commun 8(1):1444

 [21] Barbosa TM., Levy SB., 2002, Activation of the Escherichia coli nfnB gene by MarA through a highly divergent marbox in a class II promoter., Mol Microbiol 45(1):191-202

 [22] Schneiders T., Levy SB., 2006, MarA mediated transcriptional repression of the rob promoter., J Biol Chem 281(15):10049-51

 [23] Price GP., St John AC., 2000, Purification and analysis of expression of the stationary phase-inducible slp lipoprotein in Escherichia coli: role of the Mar system., FEMS Microbiol Lett 193(1):51-6

 [24] Seoane AS., Levy SB., 1995, Identification of new genes regulated by the marRAB operon in Escherichia coli., J Bacteriol 177(3):530-5

 [25] Aono R., Tsukagoshi N., Yamamoto M., 1998, Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12., J Bacteriol 180(4):938-44

 [26] Zhang A., Rosner JL., Martin RG., 2008, Transcriptional activation by MarA, SoxS and Rob of two tolC promoters using one binding site: a complex promoter configuration for tolC in Escherichia coli., Mol Microbiol 69(6):1450-5

 [27] Lee JH., Lee KL., Yeo WS., Park SJ., Roe JH., 2009, SoxRS-mediated lipopolysaccharide modification enhances resistance against multiple drugs in Escherichia coli., J Bacteriol 191(13):4441-50

 [28] Kettles RA., Tschowri N., Lyons KJ., Sharma P., Hengge R., Webber MA., Grainger DC., 2019, The Escherichia coli MarA protein regulates the ycgZ-ymgABC operon to inhibit biofilm formation., Mol Microbiol 112(5):1609-1625

 [29] Jair KW., Yu X., Skarstad K., Thony B., Fujita N., Ishihama A., Wolf RE., 1996, Transcriptional activation of promoters of the superoxide and multiple antibiotic resistance regulons by Rob, a binding protein of the Escherichia coli origin of chromosomal replication., J Bacteriol 178(9):2507-13

 [30] Rosenberg EY., Bertenthal D., Nilles ML., Bertrand KP., Nikaido H., 2003, Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein., Mol Microbiol 48(6):1609-19

 [31] Pomposiello PJ., Koutsolioutsou A., Carrasco D., Demple B., 2003, SoxRS-regulated expression and genetic analysis of the yggX gene of Escherichia coli., J Bacteriol 185(22):6624-32

 [32] Wood TI., Griffith KL., Fawcett WP., Jair KW., Schneider TD., Wolf RE., 1999, Interdependence of the position and orientation of SoxS binding sites in the transcriptional activation of the class I subset of Escherichia coli superoxide-inducible promoters., Mol Microbiol 34(3):414-30

 [33] Dangi B., Pelupessey P., Martin RG., Rosner JL., Louis JM., Gronenborn AM., 2001, Structure and dynamics of MarA-DNA complexes: an NMR investigation., J Mol Biol 314(1):113-27

 [34] Griffith KL., Wolf RE., 2001, Systematic mutagenesis of the DNA binding sites for SoxS in the Escherichia coli zwf and fpr promoters: identifying nucleotides required for DNA binding and transcription activation., Mol Microbiol 40(5):1141-54

 [35] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410
