RegulonDB RegulonDB 10.9:Regulon Page
   

IscR DNA-binding transcriptional dual regulator

Synonyms: IscR-a [2Fe-2S] iron-sulfur cluster, IscR
Summary:
The transcription factor IscR, for "Iron-sulfur cluster Regulator," is negatively autoregulated, and it contains an iron-sulfur cluster that could act as a sensor of iron-sulfur cluster assembly [2, 4] This protein regulates the expression of the operons that encode components of a secondary pathway of iron-sulfur cluster assembly, iron-sulfur proteins, anaerobic respiration enzymes, and biofilm formation [2, 4, 6, 12] IscR is a member of the Rrf2 family [1]and carries a predicted N-terminal helix-turn-helix DNA-binding motif and three conserved cysteines in its C terminus. IscR is a dimer in solution [1] and it contains the [2Fe-2S]1+ cluster when purified under anaerobic conditions [2] This [2Fe-2S]1+ cluster has an unusual (Cys)3(His)1 ligand scheme and is essential for cluster ligation [] Some proteins, such as SufB, IscU, EprA, and IscA, are involved in the assembly and transfer of the [2Fe-2S]cluster to IscR [] Two types of DNA-binding sites have been described for IscR: type 1 and type 2.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
IscR Functional   Apo [BPP], [GEA], [IEP] [1], [2]
IscR-a [2Fe-2S] iron-sulfur cluster Functional Covalent Holo [APPHINH], [BPP], [GEA], [IDA], [IEP], [IMP], [IPI] [1], [2], [3]
Evolutionary Family: Rrf2
Connectivity class: Local Regulator
Gene name: iscR
  Genome position: 2661643-2662131
  Length: 489 bp / 162 aa
Operon name: iscRSUA
TU(s) encoding the TF:
Transcription unit        Promoter
iscRSUA
iscRp


Regulon       
Regulated gene(s) erpA, hyaA, hyaB, hyaC, hyaD, hyaE, hyaF, iscA, iscR, iscS, iscU, napA, napB, napC, napD, napF, napG, napH, nfuA, nrdE, nrdF, nrdH, nrdI, rnlA, rnlB, sufA, sufB, sufC, sufD, sufE, sufS, ydiU
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
anaerobic respiration (13)
aerobic respiration (7)
incorporation of metal ions (7)
sulfur metabolism (7)
chaperoning, repair (refolding) (5)
Read more >
Regulated operon(s) erpA, hyaABCDEF, iscRSUA, napFDAGHBC-ccmABCDEFGH, nrdHIEF, rnlAB, sufABCDSE, ydiU, yhgH-nfuA
First gene in the operon(s) erpA, hyaA, iscR, napF, nfuA, nrdH, rnlA, sufA, ydiU
Simple and complex regulons AppY,ArcA,Fis,IscR,NarL,NarP,YdeO
Fur,IHF,IscR,NsrR,OxyR
Fur,IscR,NrdR
IscR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[IscR,+](3)
[IscR,-](7)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  IscR repressor erpAp nd -28.0 -77.0 erpA
gccagcgagaATACTTGAACGAAATACCAGGGTATTagataatggc
 176521 176545 [BPP], [GEA] [4]
  IscR repressor hyaAp Sigma70 -42.0 -197.0 hyaA, hyaB, hyaC, hyaD, hyaE, hyaF
cgctaaaagaTAAATCCACACAGTTTGTATTGTTTTgtgcaaaagt
 1031930 1031954 [BPP], [GEA] [4]
  IscR repressor hyaAp Sigma70 -39.0 -194.0 hyaA, hyaB, hyaC, hyaD, hyaE, hyaF
taaaagataaATCCACACAGTTTGTATTGTTTTGTGcaaaagtttc
 1031933 1031957 [APIORCISFBSCS], [BPP], [GEA] [5]
  IscR repressor hyaAp2 Sigma38 -42.0 -197.0 hyaA, hyaB, hyaC, hyaD, hyaE, hyaF
cgctaaaagaTAAATCCACACAGTTTGTATTGTTTTgtgcaaaagt
 1031930 1031954 [BPP], [GEA] [4]
  IscR repressor hyaAp2 Sigma38 -39.0 -194.0 hyaA, hyaB, hyaC, hyaD, hyaE, hyaF
taaaagataaATCCACACAGTTTGTATTGTTTTGTGcaaaagtttc
 1031933 1031957 [APIORCISFBSCS], [BPP], [GEA] [5]
  IscR-a [2Fe-2S] iron-sulfur cluster repressor iscRp Sigma70 -53.0 -121.0 iscR, iscS, iscU, iscA
ctgaaggttaAATACCCGACTAAATCAGTCAAGTAAatagttgacc
 2662240 2662264 [BPP], [GEA], [SM] [3], [4], [6]
  IscR-a [2Fe-2S] iron-sulfur cluster repressor iscRp Sigma70 -28.0 -96.0 iscR, iscS, iscU, iscA
cagtcaagtaAATAGTTGACCAATTTACTCGGGAATgtcagacttg
 2662215 2662239 [BPP], [GEA], [SM] [2], [3], [4], [6]
  IscR repressor napFp3 nd 7.0 -192.0 napF, napD, napA, napG, napH, napB, napC
taaatatattTATAACCATTTGAAATGTGAGCAAAAgcccgttttt
 2303677 2303701 [BPP], [GEA] [4]
  IscR repressor nfuAp1 nd 4.0 -25.0 nfuA
tgggcgtattATAACCAACTAAAATAGTCAACTATTaggccattac
 3545587 3545611 [BPP], [GEA] [4]
  IscR activator nrdHp Sigma70 nd nd nrdH, nrdI, nrdE, nrdF
nd
 nd nd [BPP], [GEA], [IGI] [7]
  IscR repressor rnlAp2 Sigma70 -29.5 -53.5 rnlA, rnlB
taaatttagcAAATCAATACACTTCAGGGGGGTATTattgtagagt
 2765852 2765876 [APIORCISFBSCS], [BPP], [GEA] [8]
  IscR activator sufAp Sigma70 -145.5 -177.5 sufA, sufB, sufC, sufD, sufS, sufE
ccttagataaTAACCATTATCTAACAATGAGATACCtaattcttag
 1764551 1764575 [BPP], [GEA] [6], [9], [10]
  IscR activator sufAp Sigma70 -104.5 -136.5 sufA, sufB, sufC, sufD, sufS, sufE
cttagcgtgcCTGTTAACCCACACATCAGGGTCTATgcttattaaa
 1764510 1764534 [BPP], [GEA] [6], [9], [10]
  IscR activator sufAp Sigma70 -42.5 -74.5 sufA, sufB, sufC, sufD, sufS, sufE
gttttacggtAAAGCCCCTGCGTTTGCTGGGTTGAActgataatca
 1764448 1764472 [APIORCISFBSCS], [BPP], [GEA], [IMP], [SM] [4], [6], [9], [10]
  IscR activator ydiUp nd -44.0 -54.0 ydiU
ttggttcagcGATAACCCTTCTGTTTGCTGGTGTTTaagacgagag
 1791286 1791310 [BPP], [GEA] [4]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  IscR-a [2Fe-2S] iron-sulfur cluster repressor torT Transcription-Unit nd
catctagcatAAAGCCTTATTATTGATGAGGCTATcatgcgcgta
1056235 1056259 1056247.0 nd [AIBSPD], [BPP], [CSE], [EME], [GEA] [11]


Alignment and PSSM for IscR TFBSs    

Aligned TFBS of IscR   
  Sequence
  TTACTTGACTGATTTAGTCGGGTATTT
  ATAGTTGACCAATTTACTCGGGAATGT
  ATACTTGAACGAAATACCAGGGTATTA
  ATAGTTGACTATTTTAGTTGGTTATAA
  AAATCAATACACTTCAGGGGGGTATTA
  TAAATCCACACAGTTTGTATTGTTTTG
  CCTGTTAACCCACACATCAGGGTCTAT
  TAAAGCCCCTGCGTTTGCTGGGTTGAA
  CTTTTGCTCACATTTCAAATGGTTATA
  GTATCTCATTGTTAGATAATGGTTATT
  CGATAACCCTTCTGTTTGCTGGTGTTT

Position weight matrix (PWM). IscR matrix-quality result    
A	4	3	9	2	1	2	2	7	2	2	3	6	1	3	0	7	1	2	5	0	0	0	1	5	2	3	5
C	3	1	0	2	2	2	5	2	8	4	3	3	1	0	2	1	2	3	3	0	0	0	0	1	0	0	0
G	1	1	0	3	1	1	4	0	0	0	4	0	2	1	1	0	5	2	1	7	10	10	0	1	1	1	1
T	3	6	2	4	7	6	0	2	1	5	1	2	7	7	8	3	3	4	2	4	1	1	10	4	8	7	5

Consensus    
;	consensus.strict             	ctagttcaCcgatttagcaGGGTatta
;	consensus.strict.rc          	TAATACCCTGCTAAATCGGTGAACTAG
;	consensus.IUPAC              	mtakttsaCysmtttagymKGGTwttw
;	consensus.IUPAC.rc           	WAAWACCMKRCTAAAKSRGTSAAMTAK
;	consensus.regexp             	[ac]ta[gt]tt[cg]aC[ct][cg][ac]tttag[ct][ac][GT]GGT[at]tt[at]
;	consensus.regexp.rc          	[AT]AA[AT]ACC[AC][GT][AG]CTAAA[GT][CG][AG]GT[CG]AA[AC]TA[GT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [IEP] Inferred from expression pattern

 [APPHINH] Assay of protein purified to homogeneity from its native host

 [IDA] Inferred from direct assay

 [IMP] Inferred from mutant phenotype

 [IPI] Inferred from physical interaction

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [SM] Site mutation

 [IGI] Inferred from genetic interaction

 [AIBSPD] Automated inference based on sequence pattern discovery

 [CSE] ChIP-seq evidence

 [EME] Expression microarray evidence


Reference(s)    

 [1] Nesbit AD., Giel JL., Rose JC., Kiley PJ., 2009, Sequence-specific binding to a subset of IscR-regulated promoters does not require IscR Fe-S cluster ligation., J Mol Biol 387(1):28-41

 [2] Schwartz CJ., Giel JL., Patschkowski T., Luther C., Ruzicka FJ., Beinert H., Kiley PJ., 2001, IscR, an Fe-S cluster-containing transcription factor, represses expression of Escherichia coli genes encoding Fe-S cluster assembly proteins., Proc Natl Acad Sci U S A 98(26):14895-900

 [3] Giel JL., Nesbit AD., Mettert EL., Fleischhacker AS., Wanta BT., Kiley PJ., 2013, Regulation of iron-sulphur cluster homeostasis through transcriptional control of the Isc pathway by [2Fe-2S]-IscR in Escherichia coli., Mol Microbiol 87(3):478-92

 [4] Giel JL., Rodionov D., Liu M., Blattner FR., Kiley PJ., 2006, IscR-dependent gene expression links iron-sulphur cluster assembly to the control of O-regulated genes in Escherichia coli., Mol Microbiol 60(4):1058-75

 [5] Nesbit AD., Fleischhacker AS., Teter SJ., Kiley PJ., 2012, ArcA and AppY antagonize IscR repression of hydrogenase-1 expression under anaerobic conditions, revealing a novel mode of O2 regulation of gene expression in Escherichia coli., J Bacteriol 194(24):6892-9

 [6] Yeo WS., Lee JH., Lee KC., Roe JH., 2006, IscR acts as an activator in response to oxidative stress for the suf operon encoding Fe-S assembly proteins., Mol Microbiol 61(1):206-18

 [7] Martin JE., Imlay JA., 2011, The alternative aerobic ribonucleotide reductase of Escherichia coli, NrdEF, is a manganese-dependent enzyme that enables cell replication during periods of iron starvation., Mol Microbiol 80(2):319-34

 [8] Otsuka Y., Miki K., Koga M., Katayama N., Morimoto W., Takahashi Y., Yonesaki T., 2010, IscR regulates RNase LS activity by repressing rnlA transcription., Genetics 185(3):823-30

 [9] Engl C., Jovanovic G., Brackston RD., Kotta-Loizou I., Buck M., 2020, The route to transcription initiation determines the mode of transcriptional bursting in E. coli., Nat Commun 11(1):2422

 [10] Jang S., Imlay JA., 2010, Hydrogen peroxide inactivates the Escherichia coli Isc iron-sulphur assembly system, and OxyR induces the Suf system to compensate., Mol Microbiol 78(6):1448-67

 [11] Carey JN., Mettert EL., Roggiani M., Myers KS., Kiley PJ., Goulian M., 2018, Regulated Stochasticity in a Bacterial Signaling Network Permits Tolerance to a Rapid Environmental Change., Cell 173(1):196-207.e14

 [12] Tokumoto U., Takahashi Y., 2001, Genetic analysis of the isc operon in Escherichia coli involved in the biogenesis of cellular iron-sulfur proteins., J Biochem (Tokyo) 130(1):63-71

 [13] Frazzon J., Dean DR., 2001, Feedback regulation of iron-sulfur cluster biosynthesis., Proc Natl Acad Sci U S A 98(26):14751-3

 [14] Mettert EL., Kiley PJ., 2014, Coordinate regulation of the Suf and Isc Fe-S cluster biogenesis pathways by IscR is essential for viability of Escherichia coli., J Bacteriol 196(24):4315-23


RegulonDB