![]() ![]() |
Synonyms: IscR-2Fe-2S, IscR |
Summary:
The transcription factor IscR, for "Iron-sulfur cluster Regulator," is negatively autoregulated, and it contains an iron-sulfur cluster that could act as a sensor of iron-sulfur cluster assembly [2, 4] This protein regulates the expression of the operons that encode components of a secondary pathway of iron-sulfur cluster assembly, iron-sulfur proteins, anaerobic respiration enzymes, and biofilm formation [2, 4, 6, 13] IscR is a member of the Rrf2 family [1]and carries a predicted N-terminal helix-turn-helix DNA-binding motif and three conserved cysteines in its C terminus. IscR is a dimer in solution [1] and it contains the [2Fe-2S]1+ cluster when purified under anaerobic conditions [2] This [2Fe-2S]1+ cluster has an unusual (Cys)3(His)1 ligand scheme and is essential for cluster ligation [] Some proteins, such as SufB, IscU, EprA, and IscA, are involved in the assembly and transfer of the [2Fe-2S]cluster to IscR [] Two types of DNA-binding sites have been described for IscR: type 1 and type 2. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | Rrf2 | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | iscR | ||||||||||||||||||
Genome position: | 2661643-2662131 | ||||||||||||||||||
Length: | 489 bp / 162 aa | ||||||||||||||||||
Operon name: | iscRSUA | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | erpA, hyaA, hyaB, hyaC, hyaD, hyaE, hyaF, iscA, iscR, iscS, iscU, napA, napB, napC, napD, napF, napG, napH, nfuA, nrdE, nrdF, nrdH, nrdI, rnlA, rnlB, sufA, sufB, sufC, sufD, sufE, sufS, ydiU | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
anaerobic respiration (13)
aerobic respiration (7)
incorporation of metal ions (7)
sulfur metabolism (7)
chaperoning, repair (refolding) (5)
Read more >
|
||||||
Regulated operon(s) | erpA, hyaABCDEF, iscRSUA, napFDAGHBC-ccmABCDEFGH, nrdHIEF, rnlAB, sufABCDSE, ydiU, yhgH-nfuA | ||||||
First gene in the operon(s) | erpA, hyaA, iscR, napF, nfuA, nrdH, rnlA, sufA, ydiU | ||||||
Simple and complex regulons | AppY,ArcA,Fis,IscR,NarL,NarP,YdeO Fur,IHF,IscR,NsrR,OxyR Fur,IscR,NrdR IscR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
IscR | repressor | erpAp | nd | -28.0 | -77.0 | erpA |
gccagcgagaATACTTGAACGAAATACCAGGGTATtagataatgg
|
176521 | 176545 | [BPP], [GEA] | [4] | |
IscR | repressor | hyaAp | Sigma70, Sigma38 | -42.0 | -197.0 | hyaA, hyaB, hyaC, hyaD, hyaE, hyaF |
cgctaaaagaTAAATCCACACAGTTTGTATTGTTTtgtgcaaaag
|
1031930 | 1031954 | [BPP], [GEA] | [4] | |
IscR | repressor | hyaAp | Sigma70, Sigma38 | -39.0 | -194.0 | hyaA, hyaB, hyaC, hyaD, hyaE, hyaF |
taaaagataaATCCACACAGTTTGTATTGTTTTGTgcaaaagttt
|
1031933 | 1031957 | [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [5] | |
IscR-2Fe-2S | repressor | iscRp | Sigma70 | -53.0 | -121.0 | iscR, iscS, iscU, iscA |
tgaaggttaaATACCCGACTAAATCAGTCAAGTAAatagttgacc
|
2662240 | 2662264 | [BPP], [CV(CHIP-SV/SM)], [GEA], [SM] | [3], [4], [6] | |
IscR-2Fe-2S | repressor | iscRp | Sigma70 | -28.0 | -96.0 | iscR, iscS, iscU, iscA |
agtcaagtaaATAGTTGACCAATTTACTCGGGAATgtcagacttg
|
2662215 | 2662239 | [BPP], [CV(CHIP-SV/SM)], [GEA], [SM] | [2], [3], [4], [6] | |
IscR | repressor | napFp3 | nd | 7.0 | -192.0 | napF, napD, napA, napG, napH, napB, napC |
aaatatatttATAACCATTTGAAATGTGAGCAAAAgcccgttttt
|
2303677 | 2303701 | [BPP], [GEA] | [4] | |
IscR | repressor | nfuAp1 | nd | 4.0 | -25.0 | nfuA |
tgggcgtattATAACCAACTAAAATAGTCAACTATtaggccatta
|
3545587 | 3545611 | [BPP], [GEA] | [4] | |
IscR | activator | nrdHp | Sigma70 | nd | nd | nrdH, nrdI, nrdE, nrdF | nd | nd | [GEA] | [7] | ||
IscR | repressor | rnlAp2 | Sigma70 | -29.5 | -53.5 | rnlA, rnlB |
taaatttagcAAATCAATACACTTCAGGGGGGTATtattgtagag
|
2765852 | 2765876 | [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] | [8] | |
IscR | activator | sufAp | Sigma70 | -145.5 | -177.5 | sufA, sufB, sufC, sufD, sufS, sufE |
cttagataatAACCATTATCTAACAATGAGATACCtaattcttag
|
1764551 | 1764575 | [BPP], [GEA] | [6], [9] | |
IscR | activator | sufAp | Sigma70 | -104.5 | -136.5 | sufA, sufB, sufC, sufD, sufS, sufE |
ttagcgtgccTGTTAACCCACACATCAGGGTCTATgcttattaaa
|
1764510 | 1764534 | [BPP], [GEA] | [6], [9] | |
IscR | activator | sufAp | Sigma70 | -42.5 | -74.5 | sufA, sufB, sufC, sufD, sufS, sufE |
ttttacggtaAAGCCCCTGCGTTTGCTGGGTTGAActgataatca
|
1764448 | 1764472 | [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [IMP], [SM] | [4], [6], [9], [10], [11] | |
IscR | activator | ydiUp | nd | -44.0 | -54.0 | ydiU |
tggttcagcgATAACCCTTCTGTTTGCTGGTGTTTaagacgagag
|
1791286 | 1791310 | [BPP], [GEA] | [4] |
Functional conformation | Function | Object name | Object type | Distance to first Gene | Sequence | LeftPos | RightPos | Center Position | Growth Condition | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
IscR-2Fe-2S | repressor | torT | tu | nd |
catctagcatAAAGCCTTATTATTGATGAGGCTATcatgcgcgta
|
1056235 | 1056259 | 1056247.0 | nd | , [BPP], , , [GEA] | [12] |
Alignment and PSSM for IscR TFBSs | ![]() |
---|
Aligned TFBS of IscR |
---|
Sequence | |
---|---|
TTACTTGACTGATTTAGTCGGGTATTT | |
ATAGTTGACCAATTTACTCGGGAATGT | |
ATACTTGAACGAAATACCAGGGTATTA | |
ATAGTTGACTATTTTAGTTGGTTATAA | |
AAATCAATACACTTCAGGGGGGTATTA | |
TAAATCCACACAGTTTGTATTGTTTTG | |
CCTGTTAACCCACACATCAGGGTCTAT | |
TAAAGCCCCTGCGTTTGCTGGGTTGAA | |
CTTTTGCTCACATTTCAAATGGTTATA | |
GTATCTCATTGTTAGATAATGGTTATT | |
CGATAACCCTTCTGTTTGCTGGTGTTT |
Position weight matrix (PWM). IscR matrix-quality result |
---|
A 4 3 9 2 1 2 2 7 2 2 3 6 1 3 0 7 1 2 5 0 0 0 1 5 2 3 5 C 3 1 0 2 2 2 5 2 8 4 3 3 1 0 2 1 2 3 3 0 0 0 0 1 0 0 0 G 1 1 0 3 1 1 4 0 0 0 4 0 2 1 1 0 5 2 1 7 10 10 0 1 1 1 1 T 3 6 2 4 7 6 0 2 1 5 1 2 7 7 8 3 3 4 2 4 1 1 10 4 8 7 5 |
Consensus |
---|
; consensus.strict ctagttcaCcgatttagcaGGGTatta ; consensus.strict.rc TAATACCCTGCTAAATCGGTGAACTAG ; consensus.IUPAC mtakttsaCysmtttagymKGGTwttw ; consensus.IUPAC.rc WAAWACCMKRCTAAAKSRGTSAAMTAK ; consensus.regexp [ac]ta[gt]tt[cg]aC[ct][cg][ac]tttag[ct][ac][GT]GGT[at]tt[at] ; consensus.regexp.rc [AT]AA[AT]ACC[AC][GT][AG]CTAAA[GT][CG][AG]GT[CG]AA[AC]TA[GT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|