RegulonDB RegulonDB 9.3:Regulon Page
   

GadX DNA-binding transcriptional dual regulator

Synonyms: GadX
Summary:
The transcriptional activator GadX, for Glutamic acid decarboxylase, is positively autoregulated and controls the transcription of pH-inducible genes, including the principal acid resistance system |CITS: [12686161][11976288][11555293]|, is glutamate dependent (GAD), is also referred to as the GAD system, and its genes are involved in multidrug efflux |CITS: [12446650][18808381][12730179][16980449][18297445]|. In addition GadX also activates the transcription of the central activator involved in the acid response |CITS: [17660422]|. The physiological inducer is unknown. Richard et al. proposed that GadX can sense intracellular Na+ concentrations, but the mechanism is not known |CITS: [17768258]|.
GadX is one of the regulators of the acid resistance system and is encoded by the unusual gadXW operon, which is located in the region called the acid fitness island |CITS: [18808381]|. This operon encodes two transcriptional regulators, GadX and GadW, both of which are members of the AraC/XylS family of transcriptional regulators |CITS: [9409145][11282467][18808381]|.
The activities of GadX and GadW are indispensable upon entry into the stationary phase in response to acid pH |CITS: [11976288][12446650]|. In addition Tramonti et al. provided evidence that the transcription of the gadXW operon is regulated to a posttranscriptional level by a GadY small RNA |CITS: [18808381][15466020]|.
GadX is highly homologous to GadW (42%), and apparently both are capable of cross talk to regulate expression of the genes of this system |CITS: [18808381]|.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GadX     nd nd
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: gadX
  Genome position: 3664986-3665810
  Length: 825 bp / 274 aa
Operon name: gadAXW
TU(s) encoding the TF:
Transcription unit        Promoter
gadAX
gadAp
gadX
gadXp
gadXW
gadXp


Regulon       
Regulated gene(s) amtB, asnB, btuB, cadA, cadB, dctR, gadA, gadB, gadC, gadE, gadW, gadX, gadY, glnK, hdeA, hdeB, hdeD, hns, lon, mdtE, mdtF, murI, rpoS, slp, uspE, ybaS, ybaT, yhiD
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
pH (8)
Porters (Uni-, Sym- and Antiporters) (5)
membrane (5)
Transcription related (4)
activator (3)
Read more >
Regulated operon(s) asnB, btuB-murI, cadBA, clpPX-lon, gadAXW, gadBC, gadE-mdtEF, gadY, glnK-amtB, hdeAB-yhiD, hdeD, hns, nlpD-rpoS, slp-dctR, uspE, ybaST
First gene in the operon(s) asnB, btuB, cadB, gadA, gadB, gadE, gadE, gadW, gadX, gadX, gadY, glnK, hdeA, hdeD, hns, lon, rpoS, slp, uspE, ybaS
Simple and complex regulons AdiY,ArcA,CRP,FNR,Fis,GadE-RcsB,GadW,GadX,H-NS,RcsB,TorR
AdiY,CRP,Fis,FliZ,GadE,GadW,GadX,RcsB
ArcA,CRP,Fur,GadX,MqsA
ArcA,CadC,GadE-RcsB,GadX,H-NS,Lrp
ArcA,GadX,YdeO
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[GadX,-](2)
[GadX,+-](1)
[GadX,+](7)


Transcription factor binding sites (TFBSs) arrangements       

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  GadX activator asnBp nd nd nd asnB nd nd [GEA] [1]
  GadX repressor btuBp Sigma70 74.5 -166.5 btuB, murI
cggtaaggaaAGGTGCGATGATTGCGTTATgcggacactg
4163463 4163482 [BPP], [GEA], [HIBSCS] [2]
  GadX repressor btuBp Sigma70 105.5 -135.5 btuB, murI
cggacactgcCATTCGGTGGGAAGTCATCAtctcttagta
4163494 4163513 [BPP], [GEA] [2]
  GadX repressor btuBp Sigma70 134.5 -106.5 btuB, murI
atctcttagtATCTTAGATACCCCTCCAAGcccgaagacc
4163523 4163542 [BPP], [GEA] [2]
  GadX activator cadBp Sigma70 nd nd cadB, cadA nd nd [GEA] [1]
  GadX activator gadAp Sigma38 -121.5 -148.5 gadA, gadX
tacgataataAAGTCTGTTTTTAATATTATcatgttaaat
3667719 3667738 [BPP], [GEA], [HIBSCS] [3], [4], [5], [6], [7], [8]
  GadX activator gadAp Sigma38 -100.5 -127.5 gadA, gadX
taatattatcATGTTAAATGTTTATATTATaaaaagtcgt
3667698 3667717 [BPP], [GEA], [HIBSCS] [3], [4], [5], [6], [7], [8]
  GadX activator gadAp Sigma38 -78.0 -105.0 gadA, gadX
atattataaaAAGTCGTTTTTCTGCTTAGgattttgtta
3667676 3667694 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadAp Sigma38 -57.5 -84.5 gadA, gadX
tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc
3667655 3667674 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadAp Sigma38 -31.5 -58.5 gadA, gadX
taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta
3667629 3667648 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadAp Sigma38 -10.5 -37.5 gadA, gadX
ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata
3667608 3667627 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadBp Sigma38 -231.5 -258.5 gadB, gadC
ataataatcaAGTACTAATAGTGATATTTTaaggtctgat
1572294 1572313 [BPP], [GEA], [HIBSCS] [4], [5], [6]
  GadX activator gadBp Sigma38 -210.5 -237.5 gadB, gadC
tgatattttaAGGTCTGATTTTTACGTGATaattcaggag
1572273 1572292 [BPP], [GEA], [HIBSCS] [4], [5], [6]
  GadX activator gadBp Sigma38 -119.5 -146.5 gadB, gadC
gaatttcataTTGTATTGTTTTTCAATGAAaaaatattat
1572182 1572201 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadBp Sigma38 -98.5 -125.5 gadB, gadC
ttcaatgaaaAAATATTATTCGCGTAATATctcacgataa
1572161 1572180 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadBp Sigma38 -39.5 -66.5 gadB, gadC
atttaaacacGAGTCCTTTGCACTTGCTTActttatcgat
1572102 1572121 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadBp Sigma38 -17.5 -44.5 gadB, gadC
cttgcttactTTATCGATAAATCCTACTTTtttaatgcga
1572080 1572099 [BPP], [GEA] [3], [4], [6], [7], [8]
  GadX activator gadEp Sigma38 -595.5 -616.5 gadE, mdtE, mdtF
ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat
3657740 3657759 [GEA], [HIBSCS] [5], [8], [9], [10], [11]
  GadX activator gadEp Sigma38 -574.5 -595.5 gadE, mdtE, mdtF
aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa
3657761 3657780 [GEA], [HIBSCS] [5], [8], [9], [10], [11]
  GadX activator gadEp3 Sigma70 -50.5 -616.5 gadE
ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat
3657740 3657759 [AIBSCS], [BPP], [GEA], [HIBSCS] [5], [8], [9], [10], [11]
  GadX activator gadEp3 Sigma70 -29.5 -595.5 gadE
aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa
3657761 3657780 [BPP], [GEA], [HIBSCS] [5], [8], [9], [10], [11]
  GadX repressor gadWp2 nd -53.5 -216.5 gadW
ataacttttaCTGGAAATAAGATCAGCCATttttttataa
3664825 3664844 [GEA] [5]
  GadX repressor gadWp2 nd -32.5 -195.5 gadW
atcagccattTTTTTATAAACATAAGCTATacgctgtgcg
3664804 3664823 [GEA] [5]
  GadX activator gadXp Sigma38 nd nd gadX, gadW nd nd [GEA] [1], [4], [5]
  GadX activator gadYp Sigma38 -50.5 -50.5 gadY
cgcacagcgtATAGCTTATGTTTATAAAAAaatggctgat
3664804 3664823 [GEA] [5]
  GadX activator gadYp Sigma38 -29.5 -29.5 gadY
ttataaaaaaATGGCTGATCTTATTTCCAGtaaaagttat
3664825 3664844 [GEA] [5]
  GadX activator glnKp Sigma54 nd nd glnK, amtB nd nd [GEA] [1]
  GadX dual hdeAp Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
gcgtctaagaATGCAGTCGATTTAATAAAAatttcctaat
3656908 3656927 [AIBSCS], [GEA] [8], [12]
  GadX dual hdeAp Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
tgcatctgtaACTCATTGTATTGAAATAAAaatatctgat
3656856 3656875 [AIBSCS], [BPP], [GEA], [HIBSCS] [1], [5], [8], [12]
  GadX dual hdeAp Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
tgaaataaaaATATCTGATTTTGATATTTTccatcaacat
3656835 3656854 [BPP], [GEA], [HIBSCS] [1], [5], [8], [12]
  GadX activator hdeDp Sigma70 -115.5 -150.5 hdeD
atgttgatggAAAATATCAAAATCAGATATttttatttca
3656835 3656854 [BPP], [GEA], [HIBSCS] [1], [5], [8], [12]
  GadX activator hdeDp Sigma70 -94.5 -129.5 hdeD
atcagatattTTTATTTCAATACAATGAGTtacagatgca
3656856 3656875 [AIBSCS], [BPP], [GEA], [HIBSCS] [1], [5], [8], [12]
  GadX activator hnsp Sigma70 nd nd hns nd nd [GEA] [1]
  GadX activator lonp Sigma32 nd nd lon nd nd [GEA] [1]
  GadX activator rpoSp Sigma70 nd nd rpoS nd nd [GEA] [1]
  GadX activator slpp Sigma70 -81.5 -106.5 slp, dctR
ctaaacagaaAGGATATAAACATCAGACAGgtttacgtta
3653845 3653864 [BPP], [GEA], [HIBSCS] [5], [8]
  GadX activator slpp Sigma70 -60.5 -85.5 slp, dctR
atcagacaggTTTACGTTACTATCAGGCATatcacctcag
3653866 3653885 [AIBSCS], [BPP], [GEA] [5], [8]
  GadX activator uspEp nd nd nd uspE nd nd [GEA] [13]
  GadX activator ybaSp nd nd nd ybaS, ybaT nd nd [GEA] [1], [8]


Alignment and PSSM for GadX TFBSs    

Aligned TFBS of GadX   
  Sequence
  TCGATAAATCCTACTTTTTTA
  CCTTTGCACTTGCTTACTTTA
  GATATTACGCGAATAATATTT
  TATTGTATTGTTTTTCAATGA
  GGTCTGATTTTTACGTGATAA
  CTTAAAATATCACTATTAGTA
  TGTCTGATGTTTATATCCTTT
  AGGTTTACGTTACTATCAGGC
  TATCTGATTTTGATATTTTCC
  ATTTTTATTTCAATACAATGA
  TTTATTAAATCGACTGCATTC
  TGTTTGAAATGGCTAATTTGC
  TGGCTGATATTTTCCGTAGTC
  TAGCTTATGTTTATAAAAAAA
  TGGCTGATCTTATTTCCAGTA
  CGGATAAATCCTACTTTTTTA
  TGTAATGCCTTGCTTCCATTG
  AGGATTTTGTTATTTAAATTA
  TCGTTTTTCTGCTTAGGATTT
  TGTTAAATGTTTATATTATAA
  AGTCTGTTTTTAATATTATCA
  GCGATGATTGCGTTATGCGGA
  CGGTGGGAAGTCATCATCTCT
  TCTTAGATACCCCTCCAAGCC

Position weight matrix (PWM).   
A	4	4	0	8	4	4	18	6	6	0	0	7	12	0	12	6	5	16	1	3	13
C	4	5	0	7	0	0	1	3	4	4	7	3	6	5	3	5	6	3	0	4	6
G	3	12	10	0	2	11	2	0	6	3	3	6	0	0	1	3	3	0	6	5	1
T	13	3	14	9	18	9	3	15	8	17	14	8	6	19	8	10	10	5	17	12	4

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [GEA] Gene expression analysis

 [BPP] Binding of purified proteins

 [HIBSCS] Human inference based on similarity to consensus sequences

 [AIBSCS] Automated inference based on similarity to consensus sequences



Reference(s)    

 [1] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology. 150(Pt 1):61-72

 [2] Lei GS., Syu WJ., Liang PH., Chak KF., Hu WS., Hu ST., 2011, Repression of btuB gene transcription in Escherichia coli by the GadX protein., BMC Microbiol. 11(1):33

 [3] Giangrossi M., Zattoni S., Tramonti A., De Biase D., Falconi M., 2005, Antagonistic role of H-NS and GadX in the regulation of the glutamate decarboxylase-dependent acid resistance system in Escherichia coli., J Biol Chem. 280(22):21498-505

 [4] Ma Z., Richard H., Tucker DL., Conway T., Foster JW., 2002, Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW)., J Bacteriol. 184(24):7001-12

 [5] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol. 70(4):965-82

 [6] Tramonti A., De Canio M., Delany I., Scarlato V., De Biase D., 2006, Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli., J Bacteriol. 188(23):8118-27

 [7] Tramonti A., Visca P., De Canio M., Falconi M., De Biase D., 2002, Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system., J Bacteriol. 184(10):2603-13

 [8] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol. 185(10):3190-201

 [9] Nishino K., Senda Y., Yamaguchi A., 2008, The AraC-family regulator GadX enhances multidrug resistance in Escherichia coli by activating expression of mdtEF multidrug efflux genes., J Infect Chemother. 14(1):23-9

 [10] Sayed AK., Foster JW., 2009, A 750 bp sensory integration region directs global control of the Escherichia coli GadE acid resistance regulator., Mol Microbiol. 71(6):1435-50

 [11] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology. 153(Pt 8):2584-92

 [12] Ruiz C., McMurry LM., Levy SB., 2008, Role of the multidrug resistance regulator MarA in global regulation of the hdeAB acid resistance operon in Escherichia coli., J Bacteriol. 190(4):1290-7

 [13] Hodges AP., Dai D., Xiang Z., Woolf P., Xi C., He Y., 2010, Bayesian Network Expansion Identifies New ROS and Biofilm Regulators., PLoS One. 5(3):e9513



RegulonDB