RegulonDB RegulonDB 10.8:Regulon Page
   

GadX DNA-binding transcriptional dual regulator

Synonyms: GadX
Summary:
The transcriptional activator GadX, for "Glutamic acid decarboxylase," is positively autoregulated and controls the transcription of pH-inducible genes, including the principal acid resistance system [2], is glutamate dependent (GAD), is also referred to as the GAD system, and its genes are involved in multidrug efflux [1, 6, 7, 8, 10]. In addition GadX also activates the transcription of the central activator involved in the acid response [12]. The physiological inducer is unknown. Richard et al. proposed that GadX can sense intracellular Na+ concentrations, but the mechanism is not known []. GadX is one of the regulators of the acid resistance system and is encoded by the unusual gadXW operon, which is located in the region called the acid fitness island [6].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GadX Functional   [APPH], [GEA] [1], [2]
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: gadX
  Genome position: 3664986-3665810
  Length: 825 bp / 274 aa
Operon name: gadAXW
TU(s) encoding the TF:
Transcription unit        Promoter
gadAX
gadAp
gadX
gadXp
gadXW
gadXp


Regulon       
Regulated gene(s) amtB, asnB, btuB, cadA, cadB, dctR, dtpA, gadA, gadB, gadC, gadE, gadF, gadW, gadX, gadY, glnK, glsA, hdeA, hdeB, hdeD, hns, lon, mdtE, mdtF, murI, rpoS, slp, speG, uspE, ybaT, ydeM, ydeN, yhiD, ynfB
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
pH (9)
membrane (5)
Porters (Uni-, Sym- and Antiporters) (4)
Transcription related (4)
activator (3)
Read more >
Regulated operon(s) asnB, btuB-murI, cadBA, clpPX-lon, dtpA, gadAXW, gadBC, gadEF-mdtEF, gadY, glnK-amtB, glsA-ybaT, hdeAB-yhiD, hdeD, hns, nlpD-rpoS, slp-dctR, uspE, ydeNM, ynfB-speG
First gene in the operon(s) asnB, btuB, cadB, gadA, gadB, gadE, gadE, gadW, gadX, gadX, gadY, glnK, glsA, hdeA, hdeD, hns, lon, rpoS, slp, dtpA, uspE, ydeN, ynfB
Simple and complex regulons AdiY,ArcA,CRP,FNR,Fis,GadE-RcsB,GadW,GadX,H-NS,RcsB,TorR,ppGpp
AdiY,CRP,Fis,FliZ,GadE,GadW,GadX,RcsB
AraC,GadX,NagC
ArcA,CRP,Fur,GadX,MqsA,ppGpp
ArcA,CadC,GadE-RcsB,GadX,H-NS,Lrp,OmpR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[GadX,-](6)
[GadX,+](17)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  GadX activator asnBp nd nd nd asnB nd nd nd [GEA] [3]
  GadX repressor btuBp Sigma70 74.5 -166.5 btuB, murI
cggtaaggaaAGGTGCGATGATTGCGTTATgcggacactg
4163463 4163482 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [4]
  GadX repressor btuBp Sigma70 105.5 -135.5 btuB, murI
cggacactgcCATTCGGTGGGAAGTCATCAtctcttagta
4163494 4163513 nd [BPP], [GEA] [4]
  GadX repressor btuBp Sigma70 134.5 -106.5 btuB, murI
atctcttagtATCTTAGATACCCCTCCAAGcccgaagacc
4163523 4163542 nd [BPP], [GEA] [4]
  GadX activator cadBp Sigma70 nd nd cadB, cadA nd nd nd [GEA] [3]
  GadX activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -121.5 -148.5 gadA, gadX
tacgataataAAGTCTGTTTTTAATATTATcatgttaaat
3667719 3667738 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1], [2], [5], [6], [7], [8]
  GadX activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -100.5 -127.5 gadA, gadX
taatattatcATGTTAAATGTTTATATTATaaaaagtcgt
3667698 3667717 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1], [2], [5], [6], [7], [8]
  GadX activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -78.0 -105.0 gadA, gadX
tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta
3667676 3667695 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -57.5 -84.5 gadA, gadX
tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc
3667655 3667674 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -31.5 -58.5 gadA, gadX
taagcctgtaATGCCTTGCTTCCATTGCGGataaatccta
3667629 3667648 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -10.5 -37.5 gadA, gadX
ccattgcggaTAAATCCTACTTTTTTATTGccttcaaata
3667608 3667627 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -268.0 -295.0 gadB, gadC
ctatttttatGTAATAATTTTATAAATGCGttcaaaataa
1572330 1572349 nd , [IHBCE], [9]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -231.5 -258.5 gadB, gadC
ataataatcaAGTACTAATAGTGATATTTTaaggtctgat
1572294 1572313 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [1], [6], [7], [9]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -210.5 -237.5 gadB, gadC
tgatattttaAGGTCTGATTTTTACGTGATaattcaggag
1572273 1572292 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1], [6], [7]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -184.0 -211.0 gadB, gadC
gataattcagGAGACACAGAATGCGCATAAaaataacagc
1572246 1572265 nd , [IHBCE], [9]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -119.5 -146.5 gadB, gadC
gaatttcataTTGTATTGTTTTTCAATGAAaaaatattat
1572182 1572201 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -98.5 -125.5 gadB, gadC
ttcaatgaaaAAATATTATTCGCGTAATATctcacgataa
1572161 1572180 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -39.5 -66.5 gadB, gadC
atttaaacacGAGTCCTTTGCACTTGCTTActttatcgat
1572102 1572121 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -17.5 -44.5 gadB, gadC
cttgcttactTTATCGATAAATCCTACTTTtttaatgcga
1572080 1572099 nd [BPP], [GEA] [1], [2], [5], [7], [8]
  GadX activator gadEp Sigma38 -595.5 -616.5 gadE, gadF, mdtE, mdtF
ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat
3657740 3657759 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [6], [8], [10], [11], [12]
  GadX activator gadEp Sigma38 -574.5 -595.5 gadE, gadF, mdtE, mdtF
aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa
3657761 3657780 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [6], [8], [10], [11], [12]
  GadX activator gadEp3 Sigma70 -50.5 -616.5 gadE, gadF
ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat
3657740 3657759 nd [AIBSCS], [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [6], [8], [10], [11], [12]
  GadX activator gadEp3 Sigma70 -29.5 -595.5 gadE, gadF
aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa
3657761 3657780 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [6], [8], [10], [11], [12]
  GadX repressor gadWp2 nd -96.5 -259.5 gadW
tccctgttggCACGGGAAACTTTGTGCTCTcagtaagtta
3664868 3664887 nd , [IHBCE], [9]
  GadX repressor gadWp2 nd -68.5 -231.5 gadW
ctcagtaagtTAAATATAACTTTTACTGGAaataagatca
3664840 3664859 nd , [IHBCE], [9]
  GadX repressor gadWp2 nd -53.5 -216.5 gadW
ataacttttaCTGGAAATAAGATCAGCCATttttttataa
3664825 3664844 nd [GEA] [6]
  GadX repressor gadWp2 nd -32.5 -195.5 gadW
atcagccattTTTTTATAAACATAAGCTATacgctgtgcg
3664804 3664823 nd [GEA] [6]
  GadX activator gadXp Sigma38 nd nd gadX, gadW nd nd nd [GEA] [1], [3], [6]
  GadX activator gadYp Sigma38 -50.5 -50.5 gadY
cgcacagcgtATAGCTTATGTTTATAAAAAaatggctgat
3664804 3664823 nd [GEA] [6]
  GadX activator gadYp Sigma38 -29.5 -29.5 gadY
ttataaaaaaATGGCTGATCTTATTTCCAGtaaaagttat
3664825 3664844 nd [GEA] [6]
  GadX activator glnKp Sigma54 nd nd glnK, amtB nd nd nd [GEA] [3]
  GadX activator glsAp Sigma38 11.5 -57.5 glsA, ybaT
gttaaatcagGATGCCTGAAAATCGGCACCggggtgagga
511574 511593 nd , [CV(GEA)], [GEA], [IHBCE], [3], [8], [9]
  GadX activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
gcgtctaagaATGCAGTCGATTTAATAAAAatttcctaat
3656908 3656927 nd [AIBSCS], [CV(GEA)], [GEA] [8], [13]
  GadX repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
gcgtctaagaATGCAGTCGATTTAATAAAAatttcctaat
3656908 3656927 nd [AIBSCS], [CV(GEA)], [GEA] [8], [13]
  GadX activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
tgcatctgtaACTCATTGTATTGAAATAAAaatatctgat
3656856 3656875 nd [AIBSCS], [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [3], [6], [8], [13]
  GadX repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
tgcatctgtaACTCATTGTATTGAAATAAAaatatctgat
3656856 3656875 nd [AIBSCS], [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [3], [6], [8], [13]
  GadX activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
tgaaataaaaATATCTGATTTTGATATTTTccatcaacat
3656835 3656854 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [3], [6], [8], [13]
  GadX repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
tgaaataaaaATATCTGATTTTGATATTTTccatcaacat
3656835 3656854 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [3], [6], [8], [13]
  GadX activator hdeDp Sigma38, Sigma70 -115.5 -150.5 hdeD
atgttgatggAAAATATCAAAATCAGATATttttatttca
3656835 3656854 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [3], [6], [8], [13]
  GadX activator hdeDp Sigma38, Sigma70 -94.5 -129.5 hdeD
atcagatattTTTATTTCAATACAATGAGTtacagatgca
3656856 3656875 nd [AIBSCS], [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [3], [6], [8], [13]
  GadX activator hnsp Sigma70 nd nd hns nd nd nd [GEA] [3]
  GadX activator lonp Sigma32, Sigma70 nd nd lon nd nd nd [GEA] [3]
  GadX activator rpoSp Sigma70 nd nd rpoS nd nd nd [GEA] [3]
  GadX activator slpp Sigma70 -81.5 -106.5 slp, dctR
ctaaacagaaAGGATATAAACATCAGACAGgtttacgtta
3653845 3653864 nd [APIORCISFBSCS], [BPP], , [CV(GEA)], [CV(GEA)], [GEA], [IHBCE], [6], [8], [9]
  GadX activator slpp Sigma70 -70.5 -95.5 slp, dctR
ggatataaacATCAGACAGGTTTACGTTACtatcaggcat
3653856 3653875 nd , [IHBCE], [9]
  GadX activator slpp Sigma70 -60.5 -85.5 slp, dctR
atcagacaggTTTACGTTACTATCAGGCATatcacctcag
3653866 3653885 nd [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [6], [8]
  GadX activator slpp Sigma70 -3.0 -28.0 slp, dctR
aaagaaatatCTATTATGGTTTTAATATTTgttgataagg
3653923 3653942 nd , [IHBCE], [9]
  GadX activator slpp Sigma70 17.0 -9.0 slp, dctR
ttttaatattTGTTGATAAGGATAGTAACAtgaacatgac
3653942 3653961 nd , [IHBCE], [9]
  GadX repressor tppBp Sigma70 -151.0 -249.0 dtpA
cgttaagccaTCACCCCCCTCTCAGTGCAGtgaaaaaatc
1712510 1712529 nd , [IHBCE], [9]
  GadX activator uspEp nd nd nd uspE nd nd nd [GEA] [14]
  GadX repressor ydeNp Sigma70 -233.5 -263.5 ydeN, ydeM
cacatatttaTGCACTTGCATAACCTGTTGcatgattatt
1582778 1582797 nd , [IHBCE], [9]
  GadX repressor ydeNp Sigma70 -69.0 -99.0 ydeN, ydeM
tttttcccttTTTTTAGCTAAATCTGCTATctctttatgt
1582613 1582632 nd , [IHBCE], [9]
  GadX repressor ynfBp Sigma38 -94.5 -193.5 ynfB, speG
ttaaccacaaCCAGGGCAGAAAGCATCCAAtaatttcaca
1655605 1655624 nd , [IHBCE], [9]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  GadX activator leuZ gene 110.0
acgacactgcTTATTGCTTTGATTTTATTCttatctttcc
1991782 1991802 1991791.0 [1] [9]
  GadX activator leuZ gene 104.0
ctgcttattgCTTTGATTTTATTCTTATCTttcccatggt
1991788 1991808 1991797.0 [1] [9]
  GadX activator leuZ gene 101.0
cttattgcttTGATTTTATTCTTATCTTTCccatggtacc
1991791 1991811 1991800.0 [1] [9]
  GadX activator asnW gene -26.0
gaacgaggcgAATATTAGCGATGCCCACCCacaatgtcaa
2058119 2058139 2058128.0 [1] [9]
  GadX repressor yfgG gene -39.0
gttgtgccttAATGTAAGTACCGTCCACAGcgtgggacat
2629242 2629262 2629251.0 [1] [9]
  GadX repressor yfgG gene 126.0
tccgtcggtgCCTGGCAGCACCATCAGAGCaaaaaagaag
2629407 2629427 2629416.0 [1] [9]
  GadX activator yhiM gene -33.0
ttatcattaaTGCATATTTCAATATTAGCAgggatacctg
3634799 3634819 3634808.0 [1] [9]
  GadX activator slp gene -109.0
cctaaacagaAAGGATATAAACATCAGACAggtttacgtt
3653843 3653863 3653852.0 [1] [9]
  GadX activator slp gene -89.0
acatcagacaGGTTTACGTTACTATCAGGCatatcacctc
3653863 3653883 3653872.0 [1] [9]
  GadX activator slp gene -57.0
atcacctcagAATCAGATGAAAACTATAAAgaaatatcta
3653895 3653915 3653904.0 [1] [9]
  GadX activator slp gene -30.0
aaagaaatatCTATTATGGTTTTAATATTTgttgataagg
3653922 3653942 3653931.0 [1] [9]
  GadX activator slp gene -4.0
atttgttgatAAGGATAGTAACATGAACATgacaaaaggt
3653948 3653968 3653957.0 [1] [9]
  GadX repressor gadW gene -33.0
tttcatactgCGATTATTTCAATTTCAGTAtactaatgaa
3664642 3664662 3664651.0 [1] [9]
  GadX repressor gadW gene -196.0
cacagcgtatAGCTTATGTTTATAAAAAAAtggctgatct
3664805 3664825 3664814.0 [1] [9]
  GadX repressor gadW gene -217.0
ataaaaaaatGGCTGATCTTATTTCCAGTAaaagttatat
3664826 3664846 3664835.0 [1] [9]
  GadX repressor gadW gene -290.0
aacagggagtGTTATAACGGTTTATTAGTCtggagacggc
3664899 3664919 3664908.0 [1] [9]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| glucose 0.2%| aerobiosis| 37.0 C| pH 5.5| OD600 of 0.3| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| gadX knockout mutant| M9 minimal medium| glucose 0.2%| aerobiosis| 37.0 C| pH 5.5| OD600 of 0.3| mid exponential phase



Alignment and PSSM for GadX TFBSs    

Aligned TFBS of GadX   
  Sequence
  AAATATCAAAATCAGATATTTT
  TCACGTAAAAATCAGACCTTAA
  TAATATTAAAAACAGACTTTAT
  TACGGAAAATATCAGCCATGAT
  GGATATAAACATCAGACAGGTT
  TAACGCAATCATCGCACCTTTC
  AAATATTAAAACCATAATAGAT
  TAATATAAACATTTAACATGAT
  TCATTGAAAAACAATACAATAT
  TTACGTTACTATCAGGCATATC
  TTATCGATAAATCCTACTTTTT
  TTTTATAAACATAAGCTATACG
  TGGAAATAAGATCAGCCATTTT
  AATTAGCCATTTCAAACATTAT
  TACTATCCTTATCAACAAATAT
  CTAAGCAGAAAAACGACTTTTT
  ATTTATAAAATTATTACATAAA
  CAATAAAAAAGTAGGATTTATC
  TATTACGCGAATAATATTTTTT
  TGCAGTCGATTTAATAAAAATT
  CGCAATGGAAGCAAGGCATTAC
  TTTTAGCTAAATCTGCTATCTC
  TTATTTCAATACAATGAGTTAC
  CAGGGCAGAAAGCATCCAATAA
  TAATTTAAATAACAAAATCCTA
  TTATGCACTTGCATAACCTGTT
  TCAAGTACTAATAGTGATATTT
  AGATGATGACTTCCCACCGAAT
  AGACACAGAATGCGCATAAAAA
  TATCTTAGATACCCCTCCAAGC
  TACTGAGAGCACAAAGTTTCCC
  TAAAGTAAGCAAGTGCAAAGGA
  ATGCCTGAAAATCGGCACCGGG
  AGCCATCACCCCCCTCTCAGTG

Position weight matrix (PWM). GadX matrix-quality result   
A	8	15	19	6	16	5	18	20	25	16	25	4	12	19	6	19	8	17	10	8	14	6
C	4	3	6	7	2	6	7	5	2	8	1	8	20	5	4	9	18	7	2	3	2	8
G	1	7	3	2	12	4	4	7	3	1	3	2	1	5	14	5	0	1	2	8	3	3
T	21	9	6	19	4	19	5	2	4	9	5	20	1	5	10	1	8	9	20	15	15	17

Consensus   
;	consensus.strict             	taatgtaaaaatCagacatttt
;	consensus.strict.rc          	AAAATGTCTGATTTTTACATTA
;	consensus.IUPAC              	tratrtaramayMagmcawkwy
;	consensus.IUPAC.rc           	RWMWTGKCTKRTKTYTAYATYA
;	consensus.regexp             	t[ag]at[ag]ta[ag]a[ac]a[ct][AC]ag[ac]ca[at][gt][at][ct]
;	consensus.regexp.rc          	[AG][AT][AC][AT]TG[GT]CT[GT][AG]T[GT]T[CT]TA[CT]AT[CT]A

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [APPH] Assay of protein purified to homogeneity

 [GEA] Gene expression analysis

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [CV(GEA)] cross validation(GEA)

 [CEUMA] ChIP-exo evidence used in manual assertion

 [IHBCE] Inferred by a human based on computational evidence

 [RE] RNA-seq evidence

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [CE] ChIP-seq evidence



Reference(s)    

 [1] Ma Z., Richard H., Tucker DL., Conway T., Foster JW., 2002, Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW)., J Bacteriol 184(24):7001-12

 [2] Tramonti A., Visca P., De Canio M., Falconi M., De Biase D., 2002, Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system., J Bacteriol 184(10):2603-13

 [3] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [4] Lei GS., Syu WJ., Liang PH., Chak KF., Hu WS., Hu ST., 2011, Repression of btuB gene transcription in Escherichia coli by the GadX protein., BMC Microbiol 11(1):33

 [5] Giangrossi M., Zattoni S., Tramonti A., De Biase D., Falconi M., 2005, Antagonistic role of H-NS and GadX in the regulation of the glutamate decarboxylase-dependent acid resistance system in Escherichia coli., J Biol Chem 280(22):21498-505

 [6] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol 70(4):965-82

 [7] Tramonti A., De Canio M., Delany I., Scarlato V., De Biase D., 2006, Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli., J Bacteriol 188(23):8118-27

 [8] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol 185(10):3190-201

 [9] Seo SW., Kim D., O'Brien EJ., Szubin R., Palsson BO., 2015, Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli., Nat Commun 6:7970

 [10] Nishino K., Senda Y., Yamaguchi A., 2008, The AraC-family regulator GadX enhances multidrug resistance in Escherichia coli by activating expression of mdtEF multidrug efflux genes., J Infect Chemother 14(1):23-9

 [11] Sayed AK., Foster JW., 2009, A 750 bp sensory integration region directs global control of the Escherichia coli GadE acid resistance regulator., Mol Microbiol 71(6):1435-50

 [12] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology 153(Pt 8):2584-92

 [13] Ruiz C., McMurry LM., Levy SB., 2008, Role of the multidrug resistance regulator MarA in global regulation of the hdeAB acid resistance operon in Escherichia coli., J Bacteriol 190(4):1290-7

 [14] Hodges AP., Dai D., Xiang Z., Woolf P., Xi C., He Y., 2010, Bayesian Network Expansion Identifies New ROS and Biofilm Regulators., PLoS One 5(3):e9513

 [15] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [16] Opdyke JA., Kang JG., Storz G., 2004, GadY, a small-RNA regulator of acid response genes in Escherichia coli., J Bacteriol 186(20):6698-705



RegulonDB