RegulonDB RegulonDB 10.7:Regulon Page
   

GadW DNA-binding transcriptional dual regulator

Synonyms: GadW
Summary:
The transcription factor GadW, for "Glutamic acid decarboxylase," is negatively autoregulated and controls the transcription of the genes involved in the principal acid resistance system, is glutamate dependent (GAD), and is also referred to as the GAD system [1, 2, 3, 4, 5] In addition, GadW also activates the transcription of the central activator involved in the acid response [5] The physiological inducer is unknown. Richard et al. proposed that GadW can sense intracellular Na+ concentrations, but the mechanism is not known [8] GadW is one of the regulators in the acid resistance system and is encoded by the unusual gadXW operon, which is located in the region called the acid fitness island [2] This operon encodes two transcriptional regulators, GadX and GadW, both of which are members of the AraC/XylS family of transcriptional regulators [2, 9, 10] The activities of GadW and GadX are indispensable upon entry into the stationary phase in response to acid pH [1, 11] In addition, Tramonti et al.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GadW Functional   [APPH], [IE] [1]
Evolutionary Family: AraC/XylS
Connectivity class: Local Regulator
Gene name: gadW
  Genome position: 3663890-3664618
  Length: 729 bp / 242 aa
Operon name: gadAXW
TU(s) encoding the TF:
Transcription unit        Promoter
gadW
gadWp1
gadW
gadWp2
gadXW
gadXp


Regulon       
Regulated gene(s) dctR, gadA, gadB, gadC, gadE, gadF, gadW, gadX, gadY, hdeA, hdeB, mdtE, mdtF, slp, yhiD
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
pH (6)
Transcription related (3)
membrane (2)
activator (2)
drug resistance/sensitivity (2)
Read more >
Regulated operon(s) gadAXW, gadBC, gadEF-mdtEF, gadY, hdeAB-yhiD, slp-dctR
First gene in the operon(s) gadA, gadB, gadE, gadW, gadX, gadX, gadY, hdeA, slp
Simple and complex regulons AdiY,ArcA,CRP,FNR,Fis,GadE-RcsB,GadW,GadX,H-NS,RcsB,TorR,ppGpp
AdiY,CRP,Fis,FliZ,GadE,GadW,GadX,RcsB
CRP,EvgA,FliZ,GadE,GadW,GadX,H-NS,YdeO
FNR,GadE,GadW,GadX,H-NS,PhoB,RutR
FliZ,GadE,GadW,GadX,H-NS,Lrp,MarA,PhoP,RcsB,TorR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[GadW,-](4)
[GadW,+-](3)
[GadW,+](1)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  GadW activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -121.5 -148.5 gadA, gadX
tacgataataAAGTCTGTTTTTAATATTATcatgttaaat
3667719 3667738 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW repressor gadAp Sigma38, Sigma70, Sigma38, Sigma70 -121.5 -148.5 gadA, gadX
tacgataataAAGTCTGTTTTTAATATTATcatgttaaat
3667719 3667738 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -100.5 -127.5 gadA, gadX
taatattatcATGTTAAATGTTTATATTATaaaaagtcgt
3667698 3667717 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW repressor gadAp Sigma38, Sigma70, Sigma38, Sigma70 -100.5 -127.5 gadA, gadX
taatattatcATGTTAAATGTTTATATTATaaaaagtcgt
3667698 3667717 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -78.0 -105.0 gadA, gadX
tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta
3667676 3667695 nd [BPP], [GEA] [1], [4]
  GadW repressor gadAp Sigma38, Sigma70, Sigma38, Sigma70 -78.0 -105.0 gadA, gadX
tatattataaAAAGTCGTTTTTCTGCTTAGgattttgtta
3667676 3667695 nd [BPP], [GEA] [1], [4]
  GadW activator gadAp Sigma38, Sigma70, Sigma38, Sigma70 -57.5 -84.5 gadA, gadX
tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc
3667655 3667674 nd [BPP], [GEA] [1], [4]
  GadW repressor gadAp Sigma38, Sigma70, Sigma38, Sigma70 -57.5 -84.5 gadA, gadX
tctgcttaggATTTTGTTATTTAAATTAAGcctgtaatgc
3667655 3667674 nd [BPP], [GEA] [1], [4]
  GadW activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -231.5 -258.5 gadB, gadC
ataataatcaAGTACTAATAGTGATATTTTaaggtctgat
1572294 1572313 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW repressor gadBp Sigma38, Sigma70, Sigma38, Sigma70 -231.5 -258.5 gadB, gadC
ataataatcaAGTACTAATAGTGATATTTTaaggtctgat
1572294 1572313 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -210.5 -237.5 gadB, gadC
tgatattttaAGGTCTGATTTTTACGTGATaattcaggag
1572273 1572292 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW repressor gadBp Sigma38, Sigma70, Sigma38, Sigma70 -210.5 -237.5 gadB, gadC
tgatattttaAGGTCTGATTTTTACGTGATaattcaggag
1572273 1572292 nd [APIORCISFBSCS], [BPP], [GEA] [1], [2], [3], [4]
  GadW activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -119.5 -146.5 gadB, gadC
gaatttcataTTGTATTGTTTTTCAATGAAaaaatattat
1572182 1572201 nd [BPP], [GEA] [1], [3], [4]
  GadW repressor gadBp Sigma38, Sigma70, Sigma38, Sigma70 -119.5 -146.5 gadB, gadC
gaatttcataTTGTATTGTTTTTCAATGAAaaaatattat
1572182 1572201 nd [BPP], [GEA] [1], [3], [4]
  GadW activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -98.5 -125.5 gadB, gadC
ttcaatgaaaAAATATTATTCGCGTAATATctcacgataa
1572161 1572180 nd [BPP], [GEA] [1], [3], [4]
  GadW repressor gadBp Sigma38, Sigma70, Sigma38, Sigma70 -98.5 -125.5 gadB, gadC
ttcaatgaaaAAATATTATTCGCGTAATATctcacgataa
1572161 1572180 nd [BPP], [GEA] [1], [3], [4]
  GadW activator gadEp Sigma38 -595.5 -616.5 gadE, gadF, mdtE, mdtF
ctatggcaaaTTAGCCATTTCAAACATTATcatggctgat
3657740 3657759 nd [AIBSCS], [GEA] [2], [5]
  GadW activator gadEp Sigma38 -574.5 -595.5 gadE, gadF, mdtE, mdtF
aaacattatcATGGCTGATATTTTCCGTAGtcaggtttaa
3657761 3657780 nd [APIORCISFBSCS], [GEA] [2], [5]
  GadW repressor gadWp2 nd -53.5 -216.5 gadW
ataacttttaCTGGAAATAAGATCAGCCATttttttataa
3664825 3664844 nd [GEA] [2]
  GadW repressor gadWp2 nd -32.5 -195.5 gadW
atcagccattTTTTTATAAACATAAGCTATacgctgtgcg
3664804 3664823 nd [GEA] [2]
  GadW repressor gadXp Sigma38 nd nd gadX, gadW nd nd nd [GEA] [1]
  GadW repressor gadYp Sigma38 -50.5 -50.5 gadY
cgcacagcgtATAGCTTATGTTTATAAAAAaatggctgat
3664804 3664823 nd [GEA] [2]
  GadW repressor gadYp Sigma38 -29.5 -29.5 gadY
ttataaaaaaATGGCTGATCTTATTTCCAGtaaaagttat
3664825 3664844 nd [GEA] [2]
  GadW activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
gcgtctaagaATGCAGTCGATTTAATAAAAatttcctaat
3656908 3656927 nd [AIBSCS], [GEA] [4], [6]
  GadW repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
gcgtctaagaATGCAGTCGATTTAATAAAAatttcctaat
3656908 3656927 nd [AIBSCS], [GEA] [4], [6]
  GadW activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
tgcatctgtaACTCATTGTATTGAAATAAAaatatctgat
3656856 3656875 nd [APIORCISFBSCS], [BPP], [GEA] [2], [4], [6]
  GadW repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
tgcatctgtaACTCATTGTATTGAAATAAAaatatctgat
3656856 3656875 nd [APIORCISFBSCS], [BPP], [GEA] [2], [4], [6]
  GadW activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
tgaaataaaaATATCTGATTTTGATATTTTccatcaacat
3656835 3656854 nd [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [2], [4], [6]
  GadW repressor hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
tgaaataaaaATATCTGATTTTGATATTTTccatcaacat
3656835 3656854 nd [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [2], [4], [6]
  GadW repressor slpp Sigma70 -81.5 -106.5 slp, dctR
ctaaacagaaAGGATATAAACATCAGACAGgtttacgtta
3653845 3653864 nd [APIORCISFBSCS], [GEA] [2], [4]
  GadW repressor slpp Sigma70 -60.5 -85.5 slp, dctR
atcagacaggTTTACGTTACTATCAGGCATatcacctcag
3653866 3653885 nd [AIBSCS], [GEA] [2], [4]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  GadW activator gadW gene -958.0 3664848 3664867 [1] nd [7]
  GadW activator gadW gene -939.0 3664829 3664848 [1] nd [7]
  GadW activator gadW gene -918.0 3664808 3664827 [1] nd [7]
  GadW activator gadW gene -40.0 3664658 3664677 [1] nd [7]
  GadW activator fhuF gene 2.0 4605661 4605680 [1] nd [7]
  GadW repressor gadY gene 16.0 3664848 3664867 [1] nd [7]
  GadW repressor gadY gene 35.0 3664829 3664848 [1] nd [7]
  GadW repressor gadY gene 56.0 3664808 3664827 [1] nd [7]
  GadW repressor gadY gene 310.0 3664658 3664677 [1] nd [7]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| glucose 0.2%| aerobiosis| 37.0 C| pH 5.5| OD600 of 0.3| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| gadW knockout mutant| M9 minimal medium| glucose 0.2%| aerobiosis| 37.0 C| pH 5.5| OD600 of 0.3| mid exponential phase



Alignment and PSSM for GadW TFBSs    

Aligned TFBS of GadW   
  Sequence
  TCACGTAAAAATCAGACCTTA
  TAATATTAAAAACAGACTTTA
  AAATATCAAAATCAGATATTT
  TTACGTTACTATCAGGCATAT
  GGATATAAACATCAGACAGGT
  TAATATAAACATTTAACATGA
  TTTTATAAACATAAGCTATAC
  TACGGAAAATATCAGCCATGA
  TGGAAATAAGATCAGCCATTT
  TTATTTCAATACAATGAGTTA
  TCATTGAAAAACAATACAATA
  TGTTATTTAAATTAAGCCTGT
  AAATATCACTATTAGTACTTG
  AATTAGCCATTTCAAACATTA
  TTTATTAAATCGACTGCATTC
  CTAAGCAGAAAAACGACTTTT
  TTACGCGAATAATATTTTTTC

Position weight matrix (PWM). GadW matrix-quality result   
A	3	6	11	3	9	2	8	14	15	6	15	3	5	14	3	8	2	10	1	2	7
C	1	2	1	3	0	2	4	1	2	3	1	2	8	2	0	3	12	3	0	0	3
G	1	3	1	1	5	2	1	1	0	1	0	1	0	0	10	4	0	1	1	4	1
T	12	6	4	10	3	11	4	1	0	7	1	11	4	1	4	2	3	3	15	11	6

Consensus   
;	consensus.strict             	taatataAAtAtcAGaCaTta
;	consensus.strict.rc          	TAATGTCTGATATTTATATTA
;	consensus.IUPAC              	twatrtmAAwAtmAGrCaTkw
;	consensus.IUPAC.rc           	WMATGYCTKATWTTKAYATWA
;	consensus.regexp             	t[at]at[ag]t[ac]AA[at]At[ac]AG[ag]CaT[gt][at]
;	consensus.regexp.rc          	[AT][AC]ATG[CT]CT[GT]AT[AT]TT[GT]A[CT]AT[AT]A

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [APPH] Assay of protein purified to homogeneity

 [IE] Inferred from experiment

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences



Reference(s)    

 [1] Ma Z., Richard H., Tucker DL., Conway T., Foster JW., 2002, Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW)., J Bacteriol 184(24):7001-12

 [2] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol 70(4):965-82

 [3] Tramonti A., De Canio M., Delany I., Scarlato V., De Biase D., 2006, Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli., J Bacteriol 188(23):8118-27

 [4] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol 185(10):3190-201

 [5] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology 153(Pt 8):2584-92

 [6] Ruiz C., McMurry LM., Levy SB., 2008, Role of the multidrug resistance regulator MarA in global regulation of the hdeAB acid resistance operon in Escherichia coli., J Bacteriol 190(4):1290-7

 [7] Seo SW., Kim D., O'Brien EJ., Szubin R., Palsson BO., 2015, Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli., Nat Commun 6:7970

 [8] Richard H, Foster JW, 2007, Sodium regulates Escherichia coli acid resistance, and influences GadX- and GadW-dependent activation of gadE., Microbiology, 2007 Sep

 [9] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [10] Martin RG, Rosner JL, 2001, The AraC transcriptional activators., Curr Opin Microbiol, 2001 Apr

 [11] Tramonti A., Visca P., De Canio M., Falconi M., De Biase D., 2002, Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system., J Bacteriol 184(10):2603-13

 [12] Opdyke JA., Kang JG., Storz G., 2004, GadY, a small-RNA regulator of acid response genes in Escherichia coli., J Bacteriol 186(20):6698-705

 [13] Gallegos MT, Michán C, Ramos JL, 1993, The XylS/AraC family of regulators., Nucleic Acids Res, 1993 Feb 25



RegulonDB