RegulonDB RegulonDB 11.1:Regulon Page

GadW DNA-binding transcriptional dual regulator

Synonyms: GadW
The transcription factor GadW, for "Glutamic acid decarboxylase," is negatively autoregulated and controls the transcription of the genes involved in the principal acid resistance system, is glutamate dependent (GAD), and is also referred to as the GAD system [1, 2, 3, 4, 5] In addition, GadW also activates the transcription of the central activator involved in the acid response [4] The physiological inducer is unknown. Richard et al. proposed that GadW can sense intracellular Na+ concentrations, but the mechanism is not known [7] GadW is one of the regulators in the acid resistance system and is encoded by the unusual gadXW operon, which is located in the region called the acid fitness island [5] This operon encodes two transcriptional regulators, GadX and GadW, both of which are members of the AraC/XylS family of transcriptional regulators [5, 8, 9] The activities of GadW and GadX are indispensable upon entry into the stationary phase in response to acid pH [1, 10] In addition, Tramonti et al.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
GadW Functional   nd nd nd
Evolutionary Family: AraC/XylS
TFBs length: 20
TFBs symmetry: asymmetric
Connectivity class: Local Regulator
Gene name: gadW
  Genome position: 3663890-3664618
  Length: 729 bp / 242 aa
Operon name: gadAXW
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) dctR, gadA, gadB, gadC, gadE, gadF, gadW, gadX, gadY, hdeA, hdeB, mdtE, mdtF, slp, yhiD
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
pH (6)
Transcription related (3)
membrane (2)
activator (2)
drug resistance/sensitivity (2)
Read more >
Regulated operon(s) gadAXW, gadBC, gadEF-mdtEF, gadY, hdeAB-yhiD, slp-dctR
First gene in the operon(s) gadA, gadB, gadE, gadW, gadX, gadY, hdeA, slp
Simple and complex regulons AdiY,ArcA,CRP,FNR,Fis,GadE-RcsB,GadW,GadX,H-NS,RcsB,TorR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  GadW activator gadAp Sigma70 -121.5 -148.5 gadA, gadX
  GadW repressor gadAp Sigma70 -121.5 -148.5 gadA, gadX
  GadW activator gadAp Sigma70 -100.5 -127.5 gadA, gadX
  GadW repressor gadAp Sigma70 -100.5 -127.5 gadA, gadX
  GadW activator gadAp Sigma70 -78.0 -105.0 gadA, gadX
  GadW repressor gadAp Sigma70 -78.0 -105.0 gadA, gadX
  GadW activator gadAp Sigma70 -57.5 -84.5 gadA, gadX
  GadW repressor gadAp Sigma70 -57.5 -84.5 gadA, gadX
  GadW activator gadAp2 Sigma38 -121.5 -148.5 gadA, gadX
  GadW repressor gadAp2 Sigma38 -121.5 -148.5 gadA, gadX
  GadW activator gadAp2 Sigma38 -100.5 -127.5 gadA, gadX
  GadW repressor gadAp2 Sigma38 -100.5 -127.5 gadA, gadX
  GadW activator gadAp2 Sigma38 -78.0 -105.0 gadA, gadX
  GadW repressor gadAp2 Sigma38 -78.0 -105.0 gadA, gadX
  GadW activator gadAp2 Sigma38 -57.5 -84.5 gadA, gadX
  GadW repressor gadAp2 Sigma38 -57.5 -84.5 gadA, gadX
  GadW activator gadBp Sigma70 -231.5 -258.5 gadB, gadC
  GadW repressor gadBp Sigma70 -231.5 -258.5 gadB, gadC
  GadW activator gadBp Sigma70 -210.5 -237.5 gadB, gadC
  GadW repressor gadBp Sigma70 -210.5 -237.5 gadB, gadC
  GadW activator gadBp Sigma70 -119.5 -146.5 gadB, gadC
  GadW repressor gadBp Sigma70 -119.5 -146.5 gadB, gadC
  GadW activator gadBp Sigma70 -98.5 -125.5 gadB, gadC
  GadW repressor gadBp Sigma70 -98.5 -125.5 gadB, gadC
  GadW activator gadBp2 Sigma38 -231.5 -258.5 gadB, gadC
  GadW repressor gadBp2 Sigma38 -231.5 -258.5 gadB, gadC
  GadW activator gadBp2 Sigma38 -210.5 -237.5 gadB, gadC
  GadW repressor gadBp2 Sigma38 -210.5 -237.5 gadB, gadC
  GadW activator gadBp2 Sigma38 -119.5 -146.5 gadB, gadC
  GadW repressor gadBp2 Sigma38 -119.5 -146.5 gadB, gadC
  GadW activator gadBp2 Sigma38 -98.5 -125.5 gadB, gadC
  GadW repressor gadBp2 Sigma38 -98.5 -125.5 gadB, gadC
  GadW activator gadEp2 Sigma38 -595.5 -616.5 gadE, gadF, mdtE, mdtF
  GadW activator gadEp2 Sigma38 -574.5 -595.5 gadE, gadF, mdtE, mdtF
  GadW repressor gadWp2 nd -53.5 -216.5 gadW
  GadW repressor gadWp2 nd -32.5 -195.5 gadW
  GadW repressor gadXp Sigma38 nd nd gadX, gadW nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [1]
  GadW repressor gadYp Sigma38 -50.5 -50.5 gadY
  GadW repressor gadYp Sigma38 -29.5 -29.5 gadY
  GadW activator hdeAp Sigma70 -126.5 -177.5 hdeA, hdeB, yhiD
  GadW repressor hdeAp Sigma70 -126.5 -177.5 hdeA, hdeB, yhiD
  GadW activator hdeAp Sigma70 -74.5 -125.5 hdeA, hdeB, yhiD
  GadW repressor hdeAp Sigma70 -74.5 -125.5 hdeA, hdeB, yhiD
  GadW activator hdeAp Sigma70 -53.5 -104.5 hdeA, hdeB, yhiD
  GadW repressor hdeAp Sigma70 -53.5 -104.5 hdeA, hdeB, yhiD
  GadW activator hdeAp2 Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
  GadW repressor hdeAp2 Sigma38 -126.5 -177.5 hdeA, hdeB, yhiD
  GadW activator hdeAp2 Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
  GadW repressor hdeAp2 Sigma38 -74.5 -125.5 hdeA, hdeB, yhiD
  GadW activator hdeAp2 Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
  GadW repressor hdeAp2 Sigma38 -53.5 -104.5 hdeA, hdeB, yhiD
  GadW repressor slpp Sigma70 -81.5 -106.5 slp, dctR
  GadW repressor slpp Sigma70 -60.5 -85.5 slp, dctR

Alignment and PSSM for GadW TFBSs    

Aligned TFBS of GadW   

Position weight matrix (PWM). GadW matrix-quality result   
A	3	6	11	3	9	2	8	14	15	6	15	3	5	14	3	8	2	10	1	2	7
C	1	2	1	3	0	2	4	1	2	3	1	2	8	2	0	3	12	3	0	0	3
G	1	3	1	1	5	2	1	1	0	1	0	1	0	0	10	4	0	1	1	4	1
T	12	6	4	10	3	11	4	1	0	7	1	11	4	1	4	2	3	3	15	11	6

;	consensus.strict             	taatataAAtAtcAGaCaTta
;	consensus.strict.rc          	TAATGTCTGATATTTATATTA
;	consensus.IUPAC              	twatrtmAAwAtmAGrCaTkw
;	consensus.IUPAC.rc           	WMATGYCTKATWTTKAYATWA
;	consensus.regexp             	t[at]at[ag]t[ac]AA[at]At[ac]AG[ag]CaT[gt][at]
;	consensus.regexp.rc          	[AT][AC]ATG[CT]CT[GT]AT[AT]TT[GT]A[CT]AT[AT]A

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Ma Z., Richard H., Tucker DL., Conway T., Foster JW., 2002, Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW)., J Bacteriol 184(24):7001-12

 [2] Tramonti A., De Canio M., Delany I., Scarlato V., De Biase D., 2006, Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli., J Bacteriol 188(23):8118-27

 [3] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol 185(10):3190-201

 [4] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology 153(Pt 8):2584-92

 [5] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol 70(4):965-82

 [6] Ruiz C., McMurry LM., Levy SB., 2008, Role of the multidrug resistance regulator MarA in global regulation of the hdeAB acid resistance operon in Escherichia coli., J Bacteriol 190(4):1290-7

 [7] Richard H, Foster JW, 2007, Sodium regulates Escherichia coli acid resistance, and influences GadX- and GadW-dependent activation of gadE., Microbiology (Reading), 153(Pt 9):3154 10.1099/mic.0.2007/007575-0

 [8] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [9] Martin RG, Rosner JL, 2001, The AraC transcriptional activators., Curr Opin Microbiol, 4(2):132 10.1016/s1369-5274(00)00178-8

 [10] Tramonti A., Visca P., De Canio M., Falconi M., De Biase D., 2002, Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system., J Bacteriol 184(10):2603-13

 [11] Opdyke JA., Kang JG., Storz G., 2004, GadY, a small-RNA regulator of acid response genes in Escherichia coli., J Bacteriol 186(20):6698-705

 [12] Gallegos MT, Michán C, Ramos JL, 1993, The XylS/AraC family of regulators., Nucleic Acids Res, 21(4):807 10.1093/nar/21.4.807
