RegulonDB RegulonDB 10.6.3:Regulon Page
   

EvgA DNA-binding transcriptional activator

Synonyms: EvgA-Phosphorylated, EvgA
Summary:
The transcriptional activator EvgA initiates a complex activation cascade for gene products involved in acid resistance and multidrug resistance [4, 5, 6, 7, 13, 15]. It directly activates at least six operons, among which the safA-ydeO operon encodes two additional activator proteins. SafA is the connector protein for the PhoPQ two-component system, which is involved in acid resistance and Mg2+ homeostasis [14]. YdeO is an AraC-like transcriptional activator for at least 12 operons, including the gadE-mdtE-mdtF operon [11, 16, 16, 17]. mdtEF encodes a multidrug efflux pump, and gadE encodes the master regulator for glutamate-dependent acid resistance [18, 19]. GadE activates transcription of two additional AraC-like transcriptional activators, GadX and GadW. The EvgA-YdeO-GadE circuit is very complex and involves feedback loops and autoactivation [5, 13, 20].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
EvgA Non-Functional   Apo [AIFS] [1]
EvgA-Phosphorylated Functional Covalent Holo [AIFS], [APPH], [BPP], [IEP], [IGI], [IMP], [SM] [1], [2], [3], [4], [5], [6], [7], [8], [9]
Evolutionary Family: LuxR/UhpA
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: evgA
  Genome position: 2483755-2484369
  Length: 615 bp / 204 aa
Operon name: evgAS
TU(s) encoding the TF:
Transcription unit        Promoter
evgAS
evgAp1
evgAS
evgAp2


Regulon       
Regulated gene(s) acrD, emrK, emrY, evgA, evgS, frc, gadE, gadF, mdtE, mdtF, oxc, safA, ydeO, ydeP, yegR, yegZ, yfdE, yfdV, yfdX
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
drug resistance/sensitivity (5)
membrane (5)
Transcription related (3)
activator (3)
Electrochemical potential driven transporters (2)
Read more >
Regulated operon(s) acrD, emrKY, evgAS, gadEF-mdtEF, safA-ydeO, ydeP, yegRZ, yfdX-frc-oxc-yfdVE
First gene in the operon(s) acrD, emrK, evgA, evgA, frc, gadE, safA, ydeP, yegR, yfdX
Simple and complex regulons CRP,EvgA,FliZ,GadE,GadW,GadX,H-NS,YdeO
EvgA
EvgA,FNR
EvgA,H-NS
EvgA,H-NS,NagC,NarL,NarP,PhoP,RcsB,UvrY
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[EvgA,+](10)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  EvgA-Phosphorylated activator acrDp Sigma70 -31.5 -151.0 acrD
aatgtaatgcCTCCTACTGACCAAAGAATacttgcactt
2587435 2587453 [AIBSCS], [GEA] [10]
  EvgA-Phosphorylated activator emrKp nd -73.5 -182.5 emrK, emrY
cttcttactaATCCTACAGGCGTAAGAAttgtattgca
2483513 2483530 [AIBSCS], [BPP], [GEA], [HIBSCS] [1], [4], [11], [12]
  EvgA-Phosphorylated activator evgAp1 Sigma38 -119.5 -233.5 evgA, evgS
tgcaatacaaTTCTTACGCCTGTAGGATtagtaagaag
2483513 2483530 [AIBSCS], [BPP], [GEA], [HIBSCS] [4], [11], [12]
  EvgA-Phosphorylated activator evgAp2 Sigma70 -109.5 -233.5 evgA, evgS
tgcaatacaaTTCTTACGCCTGTAGGATtagtaagaag
2483513 2483530 [AIBSCS], [BPP], [GEA], [HIBSCS] [4], [11], [12]
  EvgA-Phosphorylated activator frcp Sigma70 -75.5 -260.5 frc
tcaccggcgcTTCTTACAGTTGTAAGAAtaacatcaca
2493506 2493523 [AIBSCS], [BPP], [GEA] [11], [13]
  EvgA-Phosphorylated activator gadEp Sigma38 nd nd gadE, gadF, mdtE, mdtF nd nd [BPP], [GEA] [5]
  EvgA-Phosphorylated activator safAp Sigma70 -51.5 -120.5 safA, ydeO
tataaacttcTGCCTACAGCTGTAAGAAactccgctca
1584071 1584088 [AIBSCS], [BPP], [GEA] [11], [13], [14]
  EvgA-Phosphorylated activator ydePp Sigma70 -74.5 -252.5 ydeP
gaaggctattAGCCTACACCTGTAAGAAaatccgcgca
1586730 1586747 [AIBSCS], [BPP], [GEA] [11], [13]
  EvgA-Phosphorylated activator yegRp Sigma70 -72.5 -115.5 yegR, yegZ
atgtccgtaaTTCCTACTTATGTAGGAAatgttgtaca
2168413 2168430 [AIBSCS], [BPP], [GEA] [11], [13]
  EvgA-Phosphorylated activator yfdXp Sigma70 -113.5 -144.5 yfdX, frc, oxc, yfdV, yfdE
aggaagcataTTCCTACAATTGTAAGACtaaaatactt
2494538 2494555 [AIBSCS], [BPP], [GEA] [11], [13]
  EvgA-Phosphorylated activator yfdXp Sigma70 -75.5 -106.5 yfdX, frc, oxc, yfdV, yfdE
cttgcgataaTAACTACAACTGTAAGATaaccctttca
2494500 2494517 [BPP], [GEA] [13]


Alignment and PSSM for EvgA TFBSs    

Aligned TFBS of EvgA   
  Sequence
  GGAGTTTCTTACAGCTGTAGGC
  GGATTTTCTTACAGGTGTAGGC
  GGCGCTTCTTACAGTTGTAAGA
  TACAATTCTTACGCCTGTAGGA
  GCATATTCCTACAATTGTAAGA
  GGGTTATCTTACAGTTGTAGTT
  AACATTTCCTACATAAGTAGGA
  AAGTATTCTTTGGTCAGTAGGA

Position weight matrix (PWM). EvgA matrix-quality result   
A	2	3	3	2	3	1	0	0	0	0	7	0	6	1	1	2	0	0	8	2	0	5
C	0	1	3	0	1	0	0	8	2	0	0	7	0	1	3	0	0	0	0	0	0	2
G	5	4	2	2	0	0	0	0	0	0	0	1	2	4	1	0	8	0	0	6	7	0
T	1	0	0	4	4	7	8	0	6	8	1	0	0	2	3	6	0	8	0	0	1	1

Consensus   
;	consensus.strict             	GgcttTTCtTACagctGTAGGa
;	consensus.strict.rc          	TCCTACAGCTGTAAGAAAAGCC
;	consensus.IUPAC              	GrvkwTTCyTACrgytGTAGGm
;	consensus.IUPAC.rc           	KCCTACARCYGTARGAAWMBYC
;	consensus.regexp             	G[ag][acg][gt][at]TTC[ct]TAC[ag]g[ct]tGTAGG[ac]
;	consensus.regexp.rc          	[GT]CCTACA[AG]C[CT]GTA[AG]GAA[AT][AC][CGT][CT]C

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [AIFS] Automated inference of function from sequence

 [APPH] Assay of protein purified to homogeneity

 [BPP] Binding of purified proteins

 [IEP] Inferred from expression pattern

 [IGI] Inferred from genetic interaction

 [IMP] Inferred from mutant phenotype

 [SM] Site mutation

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [GEA] Gene expression analysis

 [HIBSCS] Human inference based on similarity to consensus sequences



Reference(s)    

 [1] Kato A., Ohnishi H., Yamamoto K., Furuta E., Tanabe H., Utsumi R., 2000, Transcription of emrKY is regulated by the EvgA-EvgS two-component system in Escherichia coli K-12., Biosci Biotechnol Biochem 64(6):1203-9

 [2] Bock A., Gross R., 2002, The unorthodox histidine kinases BvgS and EvgS are responsive to the oxidation status of a quinone electron carrier., Eur J Biochem 269(14):3479-84

 [3] Eguchi Y., Okada T., Minagawa S., Oshima T., Mori H., Yamamoto K., Ishihama A., Utsumi R., 2004, Signal transduction cascade between EvgA/EvgS and PhoP/PhoQ two-component systems of Escherichia coli., J Bacteriol 186(10):3006-14

 [4] Eguchi Y., Oshima T., Mori H., Aono R., Yamamoto K., Ishihama A., Utsumi R., 2003, Transcriptional regulation of drug efflux genes by EvgAS, a two-component system in Escherichia coli., Microbiology 149(Pt 10):2819-28

 [5] Ma Z., Masuda N., Foster JW., 2004, Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli., J Bacteriol 186(21):7378-89

 [6] Masuda N., Church GM., 2002, Escherichia coli gene expression responsive to levels of the response regulator EvgA., J Bacteriol 184(22):6225-34

 [7] Nishino K., Inazumi Y., Yamaguchi A., 2003, Global analysis of genes regulated by EvgA of the two-component regulatory system in Escherichia coli., J Bacteriol 185(8):2667-72

 [8] Nishino K., Yamaguchi A., 2001, Overexpression of the response regulator evgA of the two-component signal transduction system modulates multidrug resistance conferred by multidrug resistance transporters., J Bacteriol 183(4):1455-8

 [9] Nishino K., Yamaguchi A., 2002, EvgA of the two-component signal transduction system modulates production of the yhiUV multidrug transporter in Escherichia coli., J Bacteriol 184(8):2319-23

 [10] Hirakawa H., Nishino K., Yamada J., Hirata T., Yamaguchi A., 2003, Beta-lactam resistance modulated by the overexpression of response regulators of two-component signal transduction systems in Escherichia coli., J Antimicrob Chemother 52(4):576-82

 [11] Masuda N., Church GM., 2003, Regulatory network of acid resistance genes in Escherichia coli., Mol Microbiol 48(3):699-712

 [12] Tanabe H., Yamasaki K., Katoh A., Yoshioka S., Utsumi R., 1998, Identification of the promoter region and the transcriptional regulatory sequence of the evgAS operon of Escherichia coli., Biosci Biotechnol Biochem 62(2):286-90

 [13] Itou J., Eguchi Y., Utsumi R., 2009, Molecular mechanism of transcriptional cascade initiated by the EvgS/EvgA system in Escherichia coli K-12., Biosci Biotechnol Biochem 73(4):870-8

 [14] Eguchi Y., Itou J., Yamane M., Demizu R., Yamato F., Okada A., Mori H., Kato A., Utsumi R., 2007, B1500, a small membrane protein, connects the two-component systems EvgS/EvgA and PhoQ/PhoP in Escherichia coli., Proc Natl Acad Sci U S A 104(47):18712-7

 [15] Foster JW, 2004, Escherichia coli acid resistance: tales of an amateur acidophile., Nat Rev Microbiol, 2004 Nov

 [16] Nishino K, Senda Y, Hayashi-Nishino M, Yamaguchi A, 2009, Role of the AraC-XylS family regulator YdeO in multi-drug resistance of Escherichia coli., J Antibiot (Tokyo), 2009 May

 [17] Martin RG, Rosner JL, 2001, The AraC transcriptional activators., Curr Opin Microbiol, 2001 Apr

 [18] Ma Z., Gong S., Richard H., Tucker DL., Conway T., Foster JW., 2003, GadE (YhiE) activates glutamate decarboxylase-dependent acid resistance in Escherichia coli K-12., Mol Microbiol 49(5):1309-20

 [19] Sayed AK., Foster JW., 2009, A 750 bp sensory integration region directs global control of the Escherichia coli GadE acid resistance regulator., Mol Microbiol 71(6):1435-50

 [20] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology 153(Pt 8):2584-92

 [21] Utsumi R, Katayama S, Ikeda M, Igaki S, Nakagawa H, Miwa A, Taniguchi M, Noda M, 1992, Cloning and sequence analysis of the evgAS genes involved in signal transduction of Escherichia coli K-12., Nucleic Acids Symp Ser, 1992

 [22] Tanabe H., Masuda T., Yamasaki K., Katoh A., Yoshioka S., Utsumi R., 1998, Molecular interaction between proteins involved in EvgAS signal transduction of Escherichia coli., Biosci Biotechnol Biochem 62(1):78-82

 [23] Bantscheff M, Perraud AL, Bock A, Rippe K, Weiss V, Glocker M, Gross R, 2000, Structure-function relationships in the Bvg and Evg two-component phosphorelay systems., Int J Med Microbiol, 2000 Oct

 [24] Perraud AL., Kimmel B., Weiss V., Gross R., 1998, Specificity of the BvgAS and EvgAS phosphorelay is mediated by the C-terminal HPt domains of the sensor proteins., Mol Microbiol 27(5):875-87



RegulonDB