![]() ![]() |
Synonyms: EvgA-phosphorylated, EvgA |
Summary:
The transcriptional activator EvgA initiates a complex activation cascade for gene products involved in acid resistance and multidrug resistance [3, 6, 7, 9, 10, 11]. It directly activates at least six operons, among which the safA-ydeO operon encodes two additional activator proteins. SafA is the connector protein for the PhoPQ two-component system, which is involved in acid resistance and Mg2+ homeostasis [8]. YdeO is an AraC-like transcriptional activator for at least 12 operons, including the gadE-mdtE-mdtF operon [4, 12, 12, 13]. mdtEF encodes a multidrug efflux pump, and gadE encodes the master regulator for glutamate-dependent acid resistance [14, 15]. GadE activates transcription of two additional AraC-like transcriptional activators, GadX and GadW. The EvgA-YdeO-GadE circuit is very complex and involves feedback loops and autoactivation [6, 7, 16]. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | LuxR/UhpA | ||||||||||||||||||
Sensing class: | External-Two-component systems | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | evgA | ||||||||||||||||||
Genome position: | 2483755-2484369 | ||||||||||||||||||
Length: | 615 bp / 204 aa | ||||||||||||||||||
Operon name: | evgAS | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | acrD, emrK, emrY, evgA, evgS, frc, gadE, gadF, mdtE, mdtF, oxc, safA, ydeO, ydeP, yegR, yegZ, yfdE, yfdV, yfdX | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
drug resistance/sensitivity (5)
membrane (5)
Transcription related (3)
activator (3)
Electrochemical potential driven transporters (2)
Read more >
|
||||||
Regulated operon(s) | acrD, emrKY, evgAS, gadEF-mdtEF, safA-ydeO, ydeP, yegRZ, yfdX-frc-oxc-yfdVE | ||||||
First gene in the operon(s) | acrD, emrK, evgA, frc, gadE, safA, ydeP, yegR, yfdX | ||||||
Simple and complex regulons | CRP,EvgA,FliZ,GadE,GadW,GadX,H-NS,YdeO EvgA EvgA,FNR EvgA,H-NS EvgA,H-NS,NagC,NarL,NarP,PhoP,RcsB,UvrY Read more > | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
EvgA-phosphorylated | activator | acrDp | Sigma70 | -31.5 | -151.5 | acrD |
aatgtaatgcCTCCTACTGACCAAAGAATacttgcactt
|
2587435 | 2587453 | [GEA], [AIBSCS] | [2] | |
EvgA-phosphorylated | activator | emrKp | nd | -73.5 | -182.5 | emrK, emrY |
cttcttactaATCCTACAGGCGTAAGAAttgtattgca
|
2483513 | 2483530 | [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] | [1], [3], [4], [5] | |
EvgA-phosphorylated | activator | evgAp1 | Sigma38 | -119.5 | -233.5 | evgA, evgS |
tgcaatacaaTTCTTACGCCTGTAGGATtagtaagaag
|
2483513 | 2483530 | [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] | [4], [5] | |
EvgA-phosphorylated | activator | evgAp2 | Sigma70 | -109.5 | -233.5 | evgA, evgS |
tgcaatacaaTTCTTACGCCTGTAGGATtagtaagaag
|
2483513 | 2483530 | [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] | [4], [5] | |
EvgA-phosphorylated | activator | frcp | Sigma70 | -75.5 | -260.5 | frc |
tcaccggcgcTTCTTACAGTTGTAAGAAtaacatcaca
|
2493506 | 2493523 | [GEA], [AIBSCS], [BPP] | [4], [6] | |
EvgA-phosphorylated | activator | gadEp2 | Sigma38 | nd | nd | gadE, gadF, mdtE, mdtF | nd | nd | [GEA], [BPP] | [7] | ||
EvgA-phosphorylated | activator | safAp | Sigma70 | -51.5 | -120.5 | safA, ydeO |
tataaacttcTGCCTACAGCTGTAAGAAactccgctca
|
1584071 | 1584088 | [GEA], [AIBSCS], [BPP] | [4], [6], [8] | |
EvgA-phosphorylated | activator | ydePp | Sigma70 | -74.5 | -252.5 | ydeP |
gaaggctattAGCCTACACCTGTAAGAAaatccgcgca
|
1586730 | 1586747 | [GEA], [AIBSCS], [BPP] | [4], [6] | |
EvgA-phosphorylated | activator | yegRp | Sigma70 | -72.5 | -115.5 | yegR, yegZ |
atgtccgtaaTTCCTACTTATGTAGGAAatgttgtaca
|
2168413 | 2168430 | [GEA], [AIBSCS], [BPP] | [4], [6] | |
EvgA-phosphorylated | activator | yfdXp | Sigma70 | -113.5 | -144.5 | yfdX, frc, oxc, yfdV, yfdE |
aggaagcataTTCCTACAATTGTAAGACtaaaatactt
|
2494538 | 2494555 | [GEA], [AIBSCS], [BPP] | [4], [6] | |
EvgA-phosphorylated | activator | yfdXp | Sigma70 | -75.5 | -106.5 | yfdX, frc, oxc, yfdV, yfdE |
cttgcgataaTAACTACAACTGTAAGATaaccctttca
|
2494500 | 2494517 | [GEA], [BPP] | [6] |
Alignment and PSSM for EvgA TFBSs | ![]() |
---|
Aligned TFBS of EvgA |
---|
Sequence | |
---|---|
GGAGTTTCTTACAGCTGTAGGC | |
GGATTTTCTTACAGGTGTAGGC | |
GGCGCTTCTTACAGTTGTAAGA | |
TACAATTCTTACGCCTGTAGGA | |
GCATATTCCTACAATTGTAAGA | |
GGGTTATCTTACAGTTGTAGTT | |
AACATTTCCTACATAAGTAGGA | |
AAGTATTCTTTGGTCAGTAGGA |
Position weight matrix (PWM). EvgA matrix-quality result |
---|
A 2 3 3 2 3 1 0 0 0 0 7 0 6 1 1 2 0 0 8 2 0 5 C 0 1 3 0 1 0 0 8 2 0 0 7 0 1 3 0 0 0 0 0 0 2 G 5 4 2 2 0 0 0 0 0 0 0 1 2 4 1 0 8 0 0 6 7 0 T 1 0 0 4 4 7 8 0 6 8 1 0 0 2 3 6 0 8 0 0 1 1 |
Consensus |
---|
; consensus.strict GgcttTTCtTACagctGTAGGa ; consensus.strict.rc TCCTACAGCTGTAAGAAAAGCC ; consensus.IUPAC GrvkwTTCyTACrgytGTAGGm ; consensus.IUPAC.rc KCCTACARCYGTARGAAWMBYC ; consensus.regexp G[ag][acg][gt][at]TTC[ct]TAC[ag]g[ct]tGTAGG[ac] ; consensus.regexp.rc [GT]CCTACA[AG]C[CT]GTA[AG]GAA[AT][AC][CGT][CT]C |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|