RegulonDB RegulonDB 10.6.3:Regulon Page

ArgR DNA-binding transcriptional dual regulator

Synonyms: ArgR-L-arginine, ArgR
ArgR complexed with L-arginine represses the transcription of several genes involved in biosynthesis and transport of arginine, transport of histidine, and its own synthesis [1, 2, 4] and activates genes for arginine catabolism [13]. ArgR is also essential for a site-specific recombination reaction that resolves plasmid ColE1 multimers to monomers and is necessary for plasmid stability [20]. The role of ArgR in this latter reaction may be structural [20]. The hexamer is the active form of ArgR, and L-arginine binds to ArgR and stabilizes the hexamer [7] and increases its DNA affinity by allosteric activation [7, 21]. ArgR belongs to the ArgR/AhrC family, whose members are widely distributed in bacteria [8].
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
ArgR Non-Functional   Apo [IDA] [1]
ArgR-L-arginine Functional Allosteric Holo [APPHINH], [BPP], [GEA], [HIFS], [IDA], [IPI] [1], [2], [3], [4], [5], [6], [7]
Evolutionary Family: ArgR
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: argR
  Genome position: 3384703-3385173
  Length: 471 bp / 156 aa
Operon name: argR
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) argA, argB, argC, argD, argE, argF, argG, argH, argI, argR, artI, artJ, artM, artP, artQ, astA, astB, astC, astD, astE, carA, carB, gltB, gltD, gltF, hisJ, hisM, hisP, hisQ, infB, lysO, metY, nusA, pnp, rbfA, rimP, rpsO, truB
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
arginine (16)
amino acids (5)
ABC superfamily, membrane component (4)
membrane (4)
other (mechanical, nutritional, oxidative stress) (4)
Read more >
Regulated operon(s) argA, argCBH, argD, argE, argF, argG, argI, argR, argT-hisJQMP, artJ, artPIQM, astCADBE, carAB, gltBDF, lysO, metY-rimP-nusA-infB-rbfA-truB-rpsO-pnp
First gene in the operon(s) argA, argC, argD, argE, argF, argG, argI, argR, artJ, artP, astC, carA, gltB, hisJ, metY, metY, lysO
Simple and complex regulons AdiY,ArgR,CRP,FNR,Fur,GadE,HdfR,IHF,Lrp,Nac
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  ArgR-L-arginine repressor argAp Sigma70 46.5 -40.0 argA
2949193 2949211 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8]
  ArgR-L-arginine repressor argAp Sigma70 67.5 -19.5 argA
2949214 2949231 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8]
  ArgR-L-arginine repressor argCp Sigma70 -3.5 -119.5 argC, argB, argH
4154873 4154890 [AIBSCS], [BCE], [BPP], [GEA], [SM] [2], [4], [8], [9]
  ArgR-L-arginine repressor argCp Sigma70 19.5 -97.5 argC, argB, argH
4154895 4154912 [AIBSCS], [BCE], [BPP], [GEA], [SM] [2], [4], [8], [9]
  ArgR-L-arginine repressor argDp Sigma70 -19.5 -60.5 argD
3490232 3490249 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8]
  ArgR-L-arginine repressor argDp Sigma70 2.5 -39.5 argD
3490211 3490228 [AIBSCS], [BPP] [2], [4], [8]
  ArgR-L-arginine repressor argEp1 Sigma70 -6.5 -56.5 argE
4154895 4154912 [AIBSCS], [BCE], [BPP], [GEA], [SM] [2], [4], [8], [9]
  ArgR-L-arginine repressor argEp1 Sigma70 16.5 -34.5 argE
4154873 4154890 [AIBSCS], [BCE], [BPP], [GEA], [SM] [2], [4], [8], [9]
  ArgR-L-arginine repressor argFp Sigma70 -22.5 -57.5 argF
290354 290371 [AIBSCS], [BCE], [BPP], [GEA] [2], [4], [6], [8], [9], [10], [11]
  ArgR-L-arginine repressor argFp Sigma70 -1.5 -36.5 argF
290333 290350 [AIBSCS], [BPP], [GEA], [SM] [2], [4], [6], [8], [9], [11]
  ArgR-L-arginine repressor argGp Sigma70 -125.5 -200.5 argG
3318428 3318445 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8], [12]
  ArgR-L-arginine repressor argGp Sigma70 -6.5 -81.5 argG
3318547 3318564 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8], [12]
  ArgR-L-arginine repressor argGp Sigma70 15.5 -60.5 argG
3318568 3318585 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8], [12]
  ArgR-L-arginine repressor argIp Sigma70 -22.5 -55.5 argI
4478358 4478375 [AIBSCS], [BCE], [BPP], [GEA] [2], [4], [8], [9]
  ArgR-L-arginine repressor argIp Sigma70 -1.5 -34.5 argI
4478337 4478354 [AIBSCS], [BCE], [BPP], [GEA] [2], [4], [8], [9]
  ArgR-L-arginine repressor argRp1 Sigma70 -27.5 -53.5 argR
3384641 3384658 [AIBSCS], [BPP], [GEA], [HIBSCS] [1], [2], [4], [8], [10]
  ArgR-L-arginine repressor argRp1 Sigma70 -7.5 -33.5 argR
3384661 3384678 [AIBSCS], [BPP], [GEA], [HIBSCS] [1], [2], [4], [8], [10]
  ArgR-L-arginine repressor artJp Sigma70 -48.5 -100.0 artJ
900666 900684 [BPP], [GEA], [SM] [3]
  ArgR-L-arginine repressor artJp Sigma70 -27.5 -79.0 artJ
900645 900663 [AIBSCS], [BPP], [GEA], [SM] [2], [3], [8]
  ArgR-L-arginine repressor artPp Sigma70 -50.5 -86.0 artP, artI, artQ, artM
903811 903829 [BPP], [GEA], [SM] [3]
  ArgR-L-arginine repressor artPp Sigma70 -29.5 -65.0 artP, artI, artQ, artM
903790 903808 [AIBSCS], [BPP], [GEA], [SM] [2], [3], [8]
  ArgR-L-arginine activator astCp2 Sigma54 -121.5 -183.5 astC, astA, astD, astB, astE
1832157 1832174 [AIBSCS], [BPP], [GEA] [13]
  ArgR-L-arginine activator astCp2 Sigma54 -99.5 -161.5 astC, astA, astD, astB, astE
1832135 1832152 [AIBSCS], [BPP], [GEA] [13]
  ArgR-L-arginine activator astCp2 Sigma54 -78.5 -140.5 astC, astA, astD, astB, astE
1832114 1832131 [AIBSCS], [BPP], [GEA] [13]
  ArgR-L-arginine activator astCp2 Sigma54 -47.5 -109.5 astC, astA, astD, astB, astE
1832083 1832100 [AIBSCS], [BPP], [GEA] [13]
  ArgR-L-arginine repressor carAp2 Sigma70 -8.5 -40.5 carA, carB
29602 29619 [AIBSCS], [BPP], [GEA], [HIBSCS], [SM] [2], [4], [8], [14], [15]
  ArgR-L-arginine repressor carAp2 Sigma70 13.5 -19.5 carA, carB
29623 29640 [AIBSCS], [BPP], [GEA], [HIBSCS], [SM] [2], [4], [8], [14], [15]
  ArgR-L-arginine repressor gltBp Sigma38, Sigma70 -352.0 -568.5 gltB, gltD, gltF
3354148 3354165 [BPP], [GEA], [HIBSCS] [16], [17]
  ArgR-L-arginine repressor gltBp Sigma38, Sigma70 -331.5 -547.5 gltB, gltD, gltF
3354169 3354186 [BPP], [GEA], [HIBSCS] [16], [17]
  ArgR-L-arginine repressor hisJp Sigma70 -83.5 -133.0 hisJ, hisQ, hisM, hisP
2426912 2426930 [BPP], [GEA], [SM] [3]
  ArgR-L-arginine repressor hisJp Sigma70 -62.5 -112.0 hisJ, hisQ, hisM, hisP
2426891 2426909 [AIBSCS], [BPP], [GEA], [SM] [2], [3], [8]
  ArgR-L-arginine repressor lysOp Sigma70 -55.5 -93.5 lysO
914942 914959 [BPP], [GEA], [SM] [18]
  ArgR-L-arginine repressor lysOp Sigma70 -34.5 -72.5 lysO
914921 914938 [BPP], [GEA], [SM] [18]
  ArgR-L-arginine repressor metYp2 Sigma70 -201.5 -287.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
3318568 3318585 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8], [12]
  ArgR-L-arginine repressor metYp2 Sigma70 -180.5 -266.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
3318547 3318564 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8], [12]
  ArgR-L-arginine repressor metYp2 Sigma70 -61.5 -147.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
3318428 3318445 [AIBSCS], [BPP], [GEA], [HIBSCS] [2], [4], [8], [12]

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  ArgR-L-arginine repressor nd nd nd 3354148 3354187 nd [AIBSCS], [BPP], [GEA] [16], [19]
Other High-throughput regulatory interactions with weak evidence

Alignment and PSSM for ArgR TFBSs    

Aligned TFBS of ArgR   

Position weight matrix (PWM). ArgR matrix-quality result   
A	11	12	13	13	11	0	1	10	23	2	17	22	17	17	25	2	2	0	17	6	6
C	6	3	1	1	2	0	0	16	0	1	1	1	1	1	1	2	3	25	2	7	3
G	1	1	4	0	6	0	30	3	2	0	8	0	2	0	1	3	4	3	6	7	2
T	13	15	13	17	12	31	0	2	6	28	5	8	11	13	4	24	22	3	6	11	20

;	consensus.strict             	ttattTGcaTaaaaattCatt
;	consensus.strict.rc          	AATGAATTTTTATGCAAATAA
;	consensus.IUPAC              	wwwwwTGmaTrawwattCabt
;	consensus.IUPAC.rc           	AVTGAATWWTYATKCAWWWWW
;	consensus.regexp             	[at][at][at][at][at]TG[ac]aT[ag]a[at][at]attCa[cgt]t
;	consensus.regexp.rc          	A[ACG]TGAAT[AT][AT]T[CT]AT[GT]CA[AT][AT][AT][AT][AT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [IDA] Inferred from direct assay

 [APPHINH] Assay of protein purified to homogeneity from its native host

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [HIFS] Human inference of function from sequence

 [IPI] Inferred from physical interaction

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [HIBSCS] Human inference based on similarity to consensus sequences

 [BCE] Binding of cellular extracts

 [SM] Site mutation


 [1] Lim DB., Oppenheim JD., Eckhardt T., Maas WK., 1987, Nucleotide sequence of the argR gene of Escherichia coli K-12 and isolation of its product, the arginine repressor., Proc Natl Acad Sci U S A 84(19):6697-701

 [2] Caldara M., Charlier D., Cunin R., 2006, The arginine regulon of Escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation., Microbiology 152(Pt 11):3343-54

 [3] Caldara M., Minh PN., Bostoen S., Massant J., Charlier D., 2007, ArgR-dependent Repression of Arginine and Histidine Transport Genes in Escherichia coli K-12., J Mol Biol 373(2):251-67

 [4] Charlier D., Roovers M., Van Vliet F., Boyen A., Cunin R., Nakamura Y., Glansdorff N., Pierard A., 1992, Arginine regulon of Escherichia coli K-12. A study of repressor-operator interactions and of in vitro binding affinities versus in vivo repression., J Mol Biol 226(2):367-86

 [5] Szwajkajzer D., Dai L., Fukayama JW., Abramczyk B., Fairman R., Carey J., 2001, Quantitative analysis of DNA binding by the Escherichia coli arginine repressor., J Mol Biol 312(5):949-62

 [6] Tian G., Lim D., Carey J., Maas WK., 1992, Binding of the arginine repressor of Escherichia coli K12 to its operator sites., J Mol Biol 226(2):387-97

 [7] Van Duyne GD., Ghosh G., Maas WK., Sigler PB., 1996, Structure of the oligomerization and L-arginine binding domain of the arginine repressor of Escherichia coli., J Mol Biol 256(2):377-91

 [8] Makarova KS., Mironov AA., Gelfand MS., 2001, Conservation of the binding site for the arginine repressor in all bacterial lineages., Genome Biol 2(4):RESEARCH0013

 [9] Cunin R., Eckhardt T., Piette J., Boyen A., Pierard A., Glansdorff N., 1983, Molecular basis for modulated regulation of gene expression in the arginine regulon of Escherichia coli K-12., Nucleic Acids Res 11(15):5007-19

 [10] Levitt M., 1992, Accurate modeling of protein conformation by automatic segment matching., J Mol Biol 226(2):507-33

 [11] Tian G., Maas WK., 1994, Mutational analysis of the arginine repressor of Escherichia coli., Mol Microbiol 13(4):599-608

 [12] Krin E., Laurent-Winter C., Bertin PN., Danchin A., Kolb A., 2003, Transcription regulation coupling of the divergent argG and metY promoters in Escherichia coli K-12., J Bacteriol 185(10):3139-46

 [13] Kiupakis AK., Reitzer L., 2002, ArgR-independent induction and ArgR-dependent superinduction of the astCADBE operon in Escherichia coli., J Bacteriol 184(11):2940-50

 [14] Charlier D., Weyens G., Roovers M., Piette J., Bocquet C., Pierard A., Glansdorff N., 1988, Molecular interactions in the control region of the carAB operon encoding Escherichia coli carbamoylphosphate synthetase., J Mol Biol 204(4):867-77

 [15] Wang H., Glansdorff N., Charlier D., 1998, The arginine repressor of Escherichia coli K-12 makes direct contacts to minor and major groove determinants of the operators., J Mol Biol 277(4):805-24

 [16] Cho S., Cho YB., Kang TJ., Kim SC., Palsson B., Cho BK., 2015, The architecture of ArgR-DNA complexes at the genome-scale in Escherichia coli., Nucleic Acids Res 43(6):3079-88

 [17] Paul L., Mishra PK., Blumenthal RM., Matthews RG., 2007, Integration of regulatory signals through involvement of multiple global regulators: control of the Escherichia coli gltBDF operon by Lrp, IHF, Crp, and ArgR., BMC Microbiol 7:2

 [18] Pathania A., Sardesai AA., 2015, Distinct Paths for Basic Amino Acid Export in Escherichia coli: YbjE (LysO) Mediates Export of L-Lysine., J Bacteriol 197(12):2036-47

 [19] Cho BK., Federowicz S., Park YS., Zengler K., Palsson BO., 2011, Deciphering the transcriptional regulatory logic of amino acid metabolism., Nat Chem Biol 8(1):65-71

 [20] Stirling CJ., Szatmari G., Stewart G., Smith MC., Sherratt DJ., 1988, The arginine repressor is essential for plasmid-stabilizing site-specific recombination at the ColE1 cer locus., EMBO J 7(13):4389-95

 [21] Jin L, Xue WF, Fukayama JW, Yetter J, Pickering M, Carey J, 2005, Asymmetric allosteric activation of the symmetric ArgR hexamer., J Mol Biol, 2005 Feb 11

 [22] Sunnerhagen M, Nilges M, Otting G, Carey J, 1997, Solution structure of the DNA-binding domain and model for the complex of multifunctional hexameric arginine repressor with DNA., Nat Struct Biol, 1997 Oct

 [23] Sénéchal H, Delesques J, Szatmari G, 2010, Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding., FEMS Microbiol Lett, 2010 Apr
