RegulonDB RegulonDB 10.10:Regulon Page

ArgR DNA-binding transcriptional dual regulator

Synonyms: ArgR, ArgR-L-arginine

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
ArgR Non-Functional   Apo [BPP], [GEA], [IDA], [IPI] [1], [2], [3]
ArgR-L-arginine Functional Allosteric Holo [BPP], [GEA], [IDA], [IPI] [1], [2], [3]
Evolutionary Family: ArgR
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: argR
  Genome position: 3384703-3385173
  Length: 471 bp / 156 aa
Operon name: argR
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) argA, argB, argC, argD, argE, argF, argG, argH, argI, argR, artI, artJ, artM, artP, artQ, astA, astB, astC, astD, astE, carA, carB, gltB, gltD, gltF, hisJ, hisM, hisP, hisQ, infB, lysO, metY, nusA, pnp, rbfA, rimP, rpsO, truB
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
arginine (16)
amino acids (5)
ABC superfamily, membrane component (4)
membrane (4)
other (mechanical, nutritional, oxidative stress) (4)
Read more >
Regulated operon(s) argA, argCBH, argD, argE, argF, argG, argI, argR, argT-hisJQMP, artJ, artPIQM, astCADBE, carAB, gltBDF, lysO, metY-rimP-nusA-infB-rbfA-truB-rpsO-pnp
First gene in the operon(s) argA, argC, argD, argE, argF, argG, argI, argR, artJ, artP, astC, carA, gltB, hisJ, lysO, metY
Simple and complex regulons AdiY,ArgR,CRP,FNR,Fur,GadE,HdfR,IHF,Lrp,Nac
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  ArgR-L-arginine repressor argAp Sigma70 46.5 -40.5 argA
2949193 2949211 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [4]
  ArgR-L-arginine repressor argAp Sigma70 67.5 -19.5 argA
2949214 2949231 [EME], [GEA], [AIBSCS], [AIBSPD], [APIORCISFBSCS], [BPP], [CEE] [1], [4]
  ArgR-L-arginine repressor argCp Sigma70 -3.5 -119.5 argC, argB, argH
4154873 4154890 [GEA], [AIBSCS], [BCE], [BPP], [SM] [1], [4]
  ArgR-L-arginine repressor argCp Sigma70 19.5 -97.5 argC, argB, argH
4154895 4154912 [EME], [GEA], [AIBSCS], [AIBSPD], [BCE], [BPP], [CEE], [SM] [1], [4]
  ArgR-L-arginine repressor argDp Sigma70 -19.5 -60.5 argD
3490232 3490249 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [4]
  ArgR-L-arginine repressor argDp Sigma70 2.5 -39.5 argD
3490211 3490228 [EME], [AIBSCS], [AIBSPD], [BPP], [CEE] [1], [4]
  ArgR-L-arginine repressor argEp1 Sigma70 -6.5 -56.5 argE
4154895 4154912 [EME], [GEA], [AIBSCS], [AIBSPD], [BCE], [BPP], [CEE], [SM] [1], [4]
  ArgR-L-arginine repressor argEp1 Sigma70 16.5 -34.5 argE
4154873 4154890 [GEA], [AIBSCS], [BCE], [BPP], [SM] [1], [4]
  ArgR-L-arginine repressor argFp Sigma70 -22.5 -57.5 argF
290354 290371 [GEA], [AIBSCS], [BCE], [BPP] [1], [4], [5]
  ArgR-L-arginine repressor argFp Sigma70 -1.5 -36.5 argF
290333 290350 [EME], [GEA], [AIBSCS], [AIBSPD], [BPP], [CEE], [SM] [1], [4], [6]
  ArgR-L-arginine repressor argGp Sigma70 -125.5 -200.5 argG
3318428 3318445 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [4], [7]
  ArgR-L-arginine repressor argGp Sigma70 -6.5 -81.5 argG
3318547 3318564 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [4], [7]
  ArgR-L-arginine repressor argGp Sigma70 15.5 -60.5 argG
3318568 3318585 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [4], [7]
  ArgR-L-arginine repressor argIp Sigma70 -22.5 -55.5 argI
4478358 4478375 [GEA], [AIBSCS], [BCE], [BPP] [1], [4]
  ArgR-L-arginine repressor argIp Sigma70 -1.5 -34.5 argI
4478337 4478354 [EME], [GEA], [AIBSCS], [AIBSPD], [BCE], [BPP], [CEE] [1], [4]
  ArgR-L-arginine repressor argRp1 Sigma70 -27.5 -53.5 argR
3384641 3384658 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [4], [5]
  ArgR-L-arginine repressor argRp1 Sigma70 -7.5 -33.5 argR
3384661 3384678 [EME], [GEA], [AIBSCS], [AIBSPD], [APIORCISFBSCS], [BPP], [CEE] [1], [4], [5]
  ArgR-L-arginine repressor artJp Sigma70 -48.5 -99.5 artJ
900666 900684 [EME], [GEA], [AIBSPD], [BPP], [CEE], [SM] [1], [8]
  ArgR-L-arginine repressor artJp Sigma70 -27.5 -78.5 artJ
900645 900663 [GEA], [AIBSCS], [BPP], [SM] [1], [8]
  ArgR repressor artPp Sigma70 -50.5 -85.5 artP, artI, artQ, artM
903811 903829 [EME], [GEA], [AIBSPD], [BPP], [CEE], [SM] [1], [8]
  ArgR repressor artPp Sigma70 -29.5 -64.5 artP, artI, artQ, artM
903790 903808 [GEA], [AIBSCS], [BPP], [SM] [1], [8]
  ArgR-L-arginine activator astCp2 Sigma54 -121.5 -183.5 astC, astA, astD, astB, astE
1832157 1832174 [EME], [GEA], [AIBSCS], [AIBSPD], [BPP], [CEE] [1], [9]
  ArgR-L-arginine activator astCp2 Sigma54 -99.5 -161.5 astC, astA, astD, astB, astE
1832135 1832152 [GEA], [AIBSCS], [BPP] [9]
  ArgR-L-arginine activator astCp2 Sigma54 -78.5 -140.5 astC, astA, astD, astB, astE
1832114 1832131 [GEA], [AIBSCS], [BPP] [9]
  ArgR-L-arginine activator astCp2 Sigma54 -47.5 -109.5 astC, astA, astD, astB, astE
1832083 1832100 [GEA], [AIBSCS], [BPP] [9]
  ArgR-L-arginine repressor carAp2 Sigma70 -8.5 -40.5 carA, carB
29602 29619 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] [1], [4], [10]
  ArgR-L-arginine repressor carAp2 Sigma70 13.5 -19.5 carA, carB
29623 29640 [EME], [GEA], [AIBSCS], [AIBSPD], [APIORCISFBSCS], [BPP], [CEE], [SM] [1], [4], [10]
  ArgR-L-arginine repressor gltBp Sigma70 -352.0 -568.0 gltB, gltD, gltF
3354148 3354165 [GEA], [APIORCISFBSCS], [BPP] [11], [12]
  ArgR-L-arginine repressor gltBp Sigma70 -331.5 -547.5 gltB, gltD, gltF
3354169 3354186 [GEA], [APIORCISFBSCS], [BPP] [11], [12]
  ArgR-L-arginine repressor gltBp2 Sigma38 -352.0 -568.0 gltB, gltD, gltF
3354148 3354165 [GEA], [APIORCISFBSCS], [BPP] [11], [12]
  ArgR-L-arginine repressor gltBp2 Sigma38 -331.5 -547.5 gltB, gltD, gltF
3354169 3354186 [GEA], [APIORCISFBSCS], [BPP] [11], [12]
  ArgR-L-arginine repressor hisJp Sigma70 -83.5 -132.5 hisJ, hisQ, hisM, hisP
2426912 2426930 [EME], [GEA], [AIBSPD], [BPP], [CEE], [SM] [1], [8]
  ArgR-L-arginine repressor hisJp Sigma70 -62.5 -111.5 hisJ, hisQ, hisM, hisP
2426891 2426909 [GEA], [AIBSCS], [BPP], [SM] [1], [8]
  ArgR-L-arginine repressor lysOp Sigma70 -55.5 -93.5 lysO
914942 914959 [EME], [GEA], [AIBSPD], [BPP], [CEE], [SM] [1], [13]
  ArgR-L-arginine repressor lysOp Sigma70 -34.5 -72.5 lysO
914921 914938 [GEA], [BPP], [SM] [13]
  ArgR-L-arginine repressor metYp2 Sigma70 -201.5 -287.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
3318568 3318585 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [7]
  ArgR-L-arginine repressor metYp2 Sigma70 -180.5 -266.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
3318547 3318564 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [7]
  ArgR-L-arginine repressor metYp2 Sigma70 -61.5 -147.5 metY, rimP, nusA, infB, rbfA, truB, rpsO, pnp
3318428 3318445 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP] [1], [7]

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  ArgR-L-arginine activator gltP Gene nd
4294256 4294295 4294275.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator ykgA Gene nd
316883 316922 316902.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator gltP Gene nd
4294288 4294327 4294307.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator yaaU Gene nd
45774 45813 45793.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator puuB Gene nd
1364244 1364283 1364263.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator eutS Gene nd
2575928 2575967 2575947.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator yraQ Gene nd
3298201 3298240 3298220.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator gltP Gene nd
4294147 4294186 4294166.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator aroP Gene nd
121792 121831 121811.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine activator yffB Gene nd
2591207 2591246 2591226.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor yhcC Transcription-Unit -117.0
3354148 3354187 3354167.0 nd [EME], [GEA], [AIBSCS], [AIBSPD], [BPP], [CEE] [1], [11], [14]
  ArgR-L-arginine repressor waaA Gene nd
3808394 3808433 3808413.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor hchA Gene nd
2035484 2035523 2035503.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor stpA Gene nd
2798743 2798782 2798762.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor cvpA Gene nd
2430869 2430908 2430888.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor dacC Gene nd
880767 880806 880786.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor gltB Gene nd
3354541 3354580 3354560.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor mcaS Gene nd
1405819 1405858 1405838.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor pyrL Gene nd
4472623 4472662 4472642.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor aroK Gene nd
3519202 3519241 3519221.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor hisL Gene nd
2089964 2090003 2089983.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor lrp Gene nd
932353 932392 932372.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor ftsZ Gene nd
105232 105271 105251.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor hchA Gene nd
2035538 2035577 2035557.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor dps Gene nd
849151 849190 849170.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor mukE Gene nd
975739 975778 975758.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor potF Gene nd
893697 893736 893716.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor pfkB Gene nd
1806222 1806261 1806241.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor ydgI Gene nd
1679490 1679529 1679509.0 nd [EME], [AIBSPD], [CEE] [1]
  ArgR-L-arginine repressor yfcC Gene nd
2416994 2417033 2417013.0 nd [EME], [AIBSPD], [CEE] [1]
Other High-throughput regulatory interactions with weak evidence

Alignment and PSSM for ArgR TFBSs    

Aligned TFBS of ArgR   

Position weight matrix (PWM). ArgR matrix-quality result   
A	11	12	13	13	11	0	1	10	23	2	17	22	17	17	25	2	2	0	17	6	6
C	6	3	1	1	2	0	0	16	0	1	1	1	1	1	1	2	3	25	2	7	3
G	1	1	4	0	6	0	30	3	2	0	8	0	2	0	1	3	4	3	6	7	2
T	13	15	13	17	12	31	0	2	6	28	5	8	11	13	4	24	22	3	6	11	20

;	consensus.strict             	ttattTGcaTaaaaattCatt
;	consensus.strict.rc          	AATGAATTTTTATGCAAATAA
;	consensus.IUPAC              	wwwwwTGmaTrawwattCabt
;	consensus.IUPAC.rc           	AVTGAATWWTYATKCAWWWWW
;	consensus.regexp             	[at][at][at][at][at]TG[ac]aT[ag]a[at][at]attCa[cgt]t
;	consensus.regexp.rc          	A[ACG]TGAAT[AT][AT]T[CT]AT[GT]CA[AT][AT][AT][AT][AT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Caldara M., Charlier D., Cunin R., 2006, The arginine regulon of Escherichia coli: whole-system transcriptome analysis discovers new genes and provides an integrated view of arginine regulation., Microbiology 152(Pt 11):3343-54

 [2] Lim DB., Oppenheim JD., Eckhardt T., Maas WK., 1987, Nucleotide sequence of the argR gene of Escherichia coli K-12 and isolation of its product, the arginine repressor., Proc Natl Acad Sci U S A 84(19):6697-701

 [3] Szwajkajzer D., Dai L., Fukayama JW., Abramczyk B., Fairman R., Carey J., 2001, Quantitative analysis of DNA binding by the Escherichia coli arginine repressor., J Mol Biol 312(5):949-62

 [4] Charlier D., Roovers M., Van Vliet F., Boyen A., Cunin R., Nakamura Y., Glansdorff N., Pierard A., 1992, Arginine regulon of Escherichia coli K-12. A study of repressor-operator interactions and of in vitro binding affinities versus in vivo repression., J Mol Biol 226(2):367-86

 [5] Levitt M., 1992, Accurate modeling of protein conformation by automatic segment matching., J Mol Biol 226(2):507-33

 [6] Tian G., Maas WK., 1994, Mutational analysis of the arginine repressor of Escherichia coli., Mol Microbiol 13(4):599-608

 [7] Krin E., Laurent-Winter C., Bertin PN., Danchin A., Kolb A., 2003, Transcription regulation coupling of the divergent argG and metY promoters in Escherichia coli K-12., J Bacteriol 185(10):3139-46

 [8] Caldara M., Minh PN., Bostoen S., Massant J., Charlier D., 2007, ArgR-dependent repression of arginine and histidine transport genes in Escherichia coli K-12., J Mol Biol 373(2):251-67

 [9] Kiupakis AK., Reitzer L., 2002, ArgR-independent induction and ArgR-dependent superinduction of the astCADBE operon in Escherichia coli., J Bacteriol 184(11):2940-50

 [10] Charlier D., Weyens G., Roovers M., Piette J., Bocquet C., Pierard A., Glansdorff N., 1988, Molecular interactions in the control region of the carAB operon encoding Escherichia coli carbamoylphosphate synthetase., J Mol Biol 204(4):867-77

 [11] Cho S., Cho YB., Kang TJ., Kim SC., Palsson B., Cho BK., 2015, The architecture of ArgR-DNA complexes at the genome-scale in Escherichia coli., Nucleic Acids Res 43(6):3079-88

 [12] Paul L., Mishra PK., Blumenthal RM., Matthews RG., 2007, Integration of regulatory signals through involvement of multiple global regulators: control of the Escherichia coli gltBDF operon by Lrp, IHF, Crp, and ArgR., BMC Microbiol 7:2

 [13] Pathania A., Sardesai AA., 2015, Distinct Paths for Basic Amino Acid Export in Escherichia coli: YbjE (LysO) Mediates Export of L-Lysine., J Bacteriol 197(12):2036-47

 [14] Cho BK., Federowicz S., Park YS., Zengler K., Palsson BO., 2011, Deciphering the transcriptional regulatory logic of amino acid metabolism., Nat Chem Biol 8(1):65-71
