RegulonDB RegulonDB 11.0:Regulon Page
   

FadR DNA-binding transcriptional dual regulator

Synonyms: FadR, FadR-an acyl-CoA
Summary:
FadR, Fatty acid degradation Regulon [16], is a multifunctional dual regulator [17] that exerts negative control over the fatty acid degradative regulon [18, 19] and acetate metabolism [20], whereas it is responsible for maximal expression of unsaturated fatty acid biosynthesis [21]. FadR coordinately regulates fatty acid biosynthesis and fatty acid degradation at the level of transcription [22]. In this way, FadR functions as a switch between fatty acid β-oxidation and fatty acid biosynthesis [23]. FadR is a global regulator of lipid metabolism and a global regulator of fatty acid (FA) metabolism, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways, degradation and synthesis [2].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
FadR Functional   Apo [BPP], [IPI] [1]
FadR-an acyl-CoA Non-Functional Allosteric Holo [BPP], [IPI] [1]
Evolutionary Family: GntR
TFBs length: 17
TFBs symmetry: inverted-repeat
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: fadR
  Genome position: 1234938-1235657
  Length: 720 bp / 239 aa
Operon name: fadR
TU(s) encoding the TF:
Transcription unit        Promoter
fadR
fadRp1
fadR
fadRp2


Regulon       
Regulated gene(s) accA, accB, accC, accD, fabA, fabB, fabD, fabG, fabH, fabI, fadA, fadB, fadD, fadE, fadH, fadI, fadJ, fadL, fadM, fadR, iclR, sroD, uspA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
fatty acids and phosphatidic acid (10)
fatty acids (10)
Transcription related (2)
repressor (2)
operon (2)
Read more >
Regulated operon(s) accA, accBC, accD, fabA, fabB, fabI, fadBA, fadD-sroD, fadE, fadH, fadIJ, fadL, fadM, fadR, iclR, uspA, yceD-rpmF-plsX-fabHDG-acpP-fabF
First gene in the operon(s) accA, accB, accD, fabA, fabB, fabH, fabI, fadB, fadD, fadE, fadH, fadI, fadL, fadM, fadR, iclR, uspA
Simple and complex regulons ArcA,CRP,FadR,HipB
ArcA,CRP,FadR,OmpR,PhoP,Rob,ppGpp
ArcA,CRP,FadR,ppGpp
ArcA,FadR
ArcA,FadR,Fis,Rob
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[FadR,+](9)
[FadR,-](8)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  FadR activator accAp2 nd -38.0 -333.0 accA
atcgtcagcgGACAGGTCAGCTTTGATgacttcagcg
208280 208296 [GEA], [AIBSCS], [BPP] [2]
  FadR activator accBp2 nd -49.0 -313.0 accB, accC
tgattatcttCCCTGATAAGACCAGTAtttagctgcc
3405115 3405131 [GEA], [AIBSCS], [BPP] [2]
  FadR activator accDp Sigma70 -49.0 -138.0 accD
aaaagtaactCCGCGGTTCGACCACTTttttatccaa
2434056 2434072 [GEA], [AIBSCS], [BPP] [2]
  FadR activator fabAp Sigma70 -38.0 -66.0 fabA
gtttattccgAACTGATCGGACTTGTTcagcgtacac
1016528 1016544 [GEA], [APIORCISFBSCS], [BCE] [3]
  FadR activator fabBp Sigma70 -39.0 -75.0 fabB
tctattaaatGGCTGATCGGACTTGTTcggcgtacaa
2441672 2441688 [GEA], [APIORCISFBSCS], [BPP] [3], [4]
  FadR activator fabHp nd -38.0 -281.0 fabH, fabD, fabG
attcagtcacCTCAACCCCGACCAGTAtaacggcgcc
1148470 1148486 [GEA], [APIORCISFBSCS], [BPP], [SM] [5], [6]
  FadR activator fabIp nd -48.0 -130.0 fabI
ccgcagcctgCTCCGGTCGGACCTGGCaactatagct
1351161 1351177 [GEA], [AIBSCS], [BPP] [2]
  FadR repressor fadBp Sigma70 9.0 -34.0 fadB, fadA
acttcgactcATCTGGTACGACCAGATcaccttgcgg
4030997 4031013 [APIORCISFBSCS], [BCE]
  FadR repressor fadDp Sigma70 -106.0 -167.0 fadD, sroD
aagaaacagcGGCTGGTCCGCTGTTTCtgcattctta
1889905 1889921 [BPP] [7], [8]
  FadR repressor fadDp Sigma70 -20.0 -81.0 fadD, sroD
gtaattatcaAGCTGGTATGATGAGTTaatattatgt
1889819 1889835 [BPP] [7], [8]
  FadR repressor fadEp nd 74.0 -30.0 fadE
atatcatcacAAGTGGTCAGACCTCCTacaagtaagg
243325 243341 [GEA], [APIORCISFBSCS], [BPP] [9]
  FadR repressor fadHp nd 4.0 -38.0 fadH
gctaaattagAACTCATCCGACCACATaacaattatt
3231619 3231635 [GEA], [APIORCISFBSCS], [BPP] [10], [11]
  FadR repressor fadIp Sigma70 8.0 -35.0 fadI, fadJ
taagactatgATCAGGTCAGACCACTTtatttatttt
2460496 2460512 [GEA], [APIORCISFBSCS], [BPP] [12]
  FadR repressor fadLp Sigma38 -17.0 -118.0 fadL
gcaacattccAGCTGGTCCGACCTATActctcgccac
2461180 2461196 [GEA], [APIORCISFBSCS], [BCE], [BPP] [8]
  FadR repressor fadLp Sigma38 9.0 -93.0 fadL
tactctcgccACTGGTCTGATTTCTAAgatgtacctc
2461205 2461221 [APIORCISFBSCS], [BCE], [BPP] [8]
  FadR repressor fadMp1 Sigma24 2.0 -41.0 fadM
aagaggtcatACCAGTTATGACCTCTGtacttataac
464353 464369 [APIORCISFBSCS] [13]
  FadR-an acyl-CoA activator fadRp1 Sigma70 -10.0 -43.0 fadR
gtagttagccCTCTGGTATGATGAGTCCaactttgttt
1234887 1234904 [AIBSCS] [6]
  FadR activator iclRp nd -54.0 -78.0 iclR
gttcaacattAACTCATCGGATCAGTTcagtaactat
4223698 4223714 [GEA], [BPP], [SM] [14]
  FadR repressor uspAp1 Sigma70 5.0 -124.0 uspA
ctataaggtaAGGATGGTCTTAACACTgaatctttac
3639979 3639995 [GEA], [APIORCISFBSCS], [BCE], [BPP] [15]
  FadR repressor uspAp1 Sigma70 97.0 -32.0 uspA
agaaacgctaGCTGGCCAGTCATCGACaactttatgg
3640071 3640087 [GEA], [APIORCISFBSCS], [BCE], [BPP] [15]


Alignment and PSSM for FadR TFBSs    

Aligned TFBS of FadR   
  Sequence
  GATCAGGTCAGACCACTTTA
  CCTCTGGTATGATGAGTCCA
  CATCTGGTACGACCAGATCA
  CAGCTGGTCCGACCTATACT
  TATGTGGTCGGATGAGTTCT
  GAACTGATCGGACTTGTTCA
  GAACTGATCCGATGAGTTAA
  TCCCTGATAAGACCAGTATT
  TGGCTGATCGGACTTGTTCG
  GCTCCGGTCGGACCTGGCAA
  TAGGAGGTCTGACCACTTGT
  AAGCTGGTATGATGAGTTAA
  CCACTGGTCTGATTTCTAAG
  TCCGCGGTTCGACCACTTTT
  CATCAAAGCTGACCTGTCCG
  TACCAGTTATGACCTCTGTA
  CCTCAACCCCGACCAGTATA
  CGGCTGGTCCGCTGTTTCTG
  TAGCTGGCCAGTCATCGACA
  TCAGTGTTAAGACCATCCTT

Position weight matrix (PWM). FadR matrix-quality result   
A	1	11	4	0	5	2	5	0	6	4	0	18	0	1	11	1	1	5	4	10
C	7	7	3	16	2	0	1	2	13	6	0	1	14	11	0	6	1	5	8	0
G	4	2	6	4	0	18	12	1	0	4	20	0	0	5	0	11	2	1	1	4
T	8	0	7	0	13	0	2	17	1	6	0	1	6	3	9	2	16	9	7	6

Consensus   
;	consensus.strict             	cagCtGGTCcGACcagttca
;	consensus.strict.rc          	TGAACTGGTCGGACCAGCTG
;	consensus.IUPAC              	ymkCtGGTMyGAYswstyyw
;	consensus.IUPAC.rc           	WRRASWSRTCRKACCAGMKR
;	consensus.regexp             	[ct][ac][gt]CtGGT[AC][ct]GA[CT][cg][at][cg]t[ct][ct][at]
;	consensus.regexp.rc          	[AT][AG][AG]A[CG][AT][CG][AG]TC[AG][GT]ACCAG[AC][GT][AG]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation




Reference(s)    

 [1] DiRusso CC., Heimert TL., Metzger AK., 1992, Characterization of FadR, a global transcriptional regulator of fatty acid metabolism in Escherichia coli. Interaction with the fadB promoter is prevented by long chain fatty acyl coenzyme A., J Biol Chem 267(12):8685-91

 [2] My L., Ghandour Achkar N., Viala JP., Bouveret E., 2015, Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR., J Bacteriol 197(11):1862-72

 [3] Feng Y., Cronan JE., 2011, Complex binding of the FabR repressor of bacterial unsaturated fatty acid biosynthesis to its cognate promoters., Mol Microbiol 80(1):195-218

 [4] Campbell JW., Cronan JE., 2001, Escherichia coli FadR positively regulates transcription of the fabB fatty acid biosynthetic gene., J Bacteriol 183(20):5982-90

 [5] My L., Rekoske B., Lemke JJ., Viala JP., Gourse RL., Bouveret E., 2013, Transcription of the Escherichia coli Fatty Acid Synthesis Operon fabHDG Is Directly Activated by FadR and Inhibited by ppGpp., J Bacteriol 195(16):3784-95

 [6] Zhang F., Ouellet M., Batth TS., Adams PD., Petzold CJ., Mukhopadhyay A., Keasling JD., 2012, Enhancing fatty acid production by the expression of the regulatory transcription factor FadR., Metab Eng 14(6):653-60

 [7] Black PN., DiRusso CC., Metzger AK., Heimert TL., 1992, Cloning, sequencing, and expression of the fadD gene of Escherichia coli encoding acyl coenzyme A synthetase., J Biol Chem 267(35):25513-20

 [8] Feng Y., Cronan JE., 2012, Crosstalk of Escherichia coli FadR with global regulators in expression of fatty acid transport genes., PLoS One 7(9):e46275

 [9] Campbell JW., Cronan JE., 2002, The enigmatic Escherichia coli fadE gene is yafH., J Bacteriol 184(13):3759-64

 [10] Cho BK., Knight EM., Palsson BO., 2006, Transcriptional regulation of the fad regulon genes of Escherichia coli by ArcA., Microbiology 152(Pt 8):2207-19

 [11] Feng Y., Cronan JE., 2010, Overlapping repressor binding sites result in additive regulation of Escherichia coli FadH by FadR and ArcA., J Bacteriol 192(17):4289-99

 [12] Campbell JW., Morgan-Kiss RM., E Cronan J., 2003, A new Escherichia coli metabolic competency: growth on fatty acids by a novel anaerobic beta-oxidation pathway., Mol Microbiol 47(3):793-805

 [13] Nie L., Ren Y., Schulz H., 2008, Identification and characterization of Escherichia coli thioesterase III that functions in fatty acid beta-oxidation., Biochemistry 47(29):7744-51

 [14] Gui L., Sunnarborg A., LaPorte DC., 1996, Regulated expression of a repressor protein: FadR activates iclR., J Bacteriol 178(15):4704-9

 [15] Farewell A., Diez AA., DiRusso CC., Nystrom T., 1996, Role of the Escherichia coli FadR regulator in stasis survival and growth phase-dependent expression of the uspA, fad, and fab genes., J Bacteriol 178(22):6443-50

 [16] Overath P., Pauli G., Schairer HU., 1969, Fatty acid degradation in Escherichia coli. An inducible acyl-CoA synthetase, the mapping of old-mutations, and the isolation of regulatory mutants., Eur J Biochem 7(4):559-74

 [17] DiRusso CC., 1988, Nucleotide sequence of the fadR gene, a multifunctional regulator of fatty acid metabolism in Escherichia coli., Nucleic Acids Res 16(16):7995-8009

 [18] Simons RW, Egan PA, Chute HT, Nunn WD, 1980, Regulation of fatty acid degradation in Escherichia coli: isolation and characterization of strains bearing insertion and temperature-sensitive mutations in gene fadR., J Bacteriol, 142(2):621 10.1128/jb.142.2.621-632.1980

 [19] Simons RW, Hughes KT, Nunn WD, 1980, Regulation of fatty acid degradation in Escherichia coli: dominance studies with strains merodiploid in gene fadR., J Bacteriol, 143(2):726 10.1128/jb.143.2.726-730.1980

 [20] Maloy SR, Nunn WD, 1981, Role of gene fadR in Escherichia coli acetate metabolism., J Bacteriol, 148(1):83 10.1128/jb.148.1.83-90.1981

 [21] Nunn WD., Giffin K., Clark D., Cronan JE., 1983, Role for fadR in unsaturated fatty acid biosynthesis in Escherichia coli., J Bacteriol 154(2):554-60

 [22] DiRusso CC., Metzger AK., Heimert TL., 1993, Regulation of transcription of genes required for fatty acid transport and unsaturated fatty acid biosynthesis in Escherichia coli by FadR., Mol Microbiol 7(2):311-22

 [23] Xu Y, Heath RJ, Li Z, Rock CO, White SW, 2001, The FadR.DNA complex. Transcriptional control of fatty acid metabolism in Escherichia coli., J Biol Chem, 276(20):17373 10.1074/jbc.M100195200

 [24] van Aalten DM, DiRusso CC, Knudsen J, Wierenga RK, 2000, Crystal structure of FadR, a fatty acid-responsive transcription factor with a novel acyl coenzyme A-binding fold., EMBO J, 19(19):5167 10.1093/emboj/19.19.5167

 [25] Haydon DJ., Guest JR., 1991, A new family of bacterial regulatory proteins., FEMS Microbiol Lett 63(2-3):291-5

 [26] Raman N, DiRusso CC, 1995, Analysis of acyl coenzyme A binding to the transcription factor FadR and identification of amino acid residues in the carboxyl terminus required for ligand binding., J Biol Chem, 270(3):1092 10.1074/jbc.270.3.1092

 [27] Raman N, Black PN, DiRusso CC, 1997, Characterization of the fatty acid-responsive transcription factor FadR. Biochemical and genetic analyses of the native conformation and functional domains., J Biol Chem, 272(49):30645 10.1074/jbc.272.49.30645

 [28] Cronan JE., Subrahmanyam S., 1998, FadR, transcriptional co-ordination of metabolic expediency., Mol Microbiol 29(4):937-43

 [29] Hartline CJ, Mannan AA, Liu D, Zhang F, Oyarzún DA, 2020, Metabolite Sequestration Enables Rapid Recovery from Fatty Acid Depletion in Escherichia coli., mBio, 11(2):None 10.1128/mBio.03112-19

 [30] van Aalten DM, Knudsen J, DiRusso CC, Kokko T, Wierenga RK, 2000, Crystallization and X-ray diffraction studies of the fatty-acid responsive transcription factor FadR from Escherichia coli., Acta Crystallogr D Biol Crystallogr, 56(Pt 4):469 10.1107/s0907444900000937

 [31] Cronan JE, 1997, In vivo evidence that acyl coenzyme A regulates DNA binding by the Escherichia coli FadR global transcription factor., J Bacteriol, 179(5):1819 10.1128/jb.179.5.1819-1823.1997

 [32] Zhang Y, Gao R, Ye H, Wang Q, Feng Y, 2014, A new glimpse of FadR-DNA crosstalk revealed by deep dissection of the E. coli FadR regulatory protein., Protein Cell, 5(12):928 10.1007/s13238-014-0107-3

 [33] Iram SH, Cronan JE, 2005, Unexpected functional diversity among FadR fatty acid transcriptional regulatory proteins., J Biol Chem, 280(37):32148 10.1074/jbc.M504054200

 [34] Brown RN, Gulig PA, 2008, Regulation of fatty acid metabolism by FadR is essential for Vibrio vulnificus to cause infection of mice., J Bacteriol, 190(23):7633 10.1128/JB.01016-08

 [35] Georgi T, Engels V, Wendisch VF, 2008, Regulation of L-lactate utilization by the FadR-type regulator LldR of Corynebacterium glutamicum., J Bacteriol, 190(3):963 10.1128/JB.01147-07

 [36] Oh HY, Lee JO, Kim OB, 2012, Increase of organic solvent tolerance of Escherichia coli by the deletion of two regulator genes, fadR and marR., Appl Microbiol Biotechnol, 96(6):1619 10.1007/s00253-012-4463-8

 [37] Yang J, Fang Y, Wang J, Wang C, Zhao L, Wang X, 2019, Deletion of regulator-encoding genes fadR, fabR and iclR to increase L-threonine production in Escherichia coli., Appl Microbiol Biotechnol, 103(11):4549 10.1007/s00253-019-09818-8

 [38] Marrakchi H, Zhang YM, Rock CO, 2002, Mechanistic diversity and regulation of Type II fatty acid synthesis., Biochem Soc Trans, 30(Pt 6):1050 10.1042/bst0301050



RegulonDB