RegulonDB RegulonDB 10.7:Regulon Page
   

GadE DNA-binding transcriptional activator

Synonyms: GadE
Summary:
The transcriptional activator GadE, for "Glutamic acid decarboxylase," is positively autoregulated [3, 14]and controls the transcription of genes involved in the maintenance of pH homeostasis, including the principal acid resistance system [3, 4, 5, 6, 8, 17, 18, 19] glutamate dependent (GAD), also referred as the GAD system, and genes involved in multidrug efflux, among others [3, 12, 13, 20, 21, 22] GadE also controls the expression of two transcription factors related to acid resistance, GadW and GadX, and for this reason it is considered the central activator of the acid response system [3, 4] GadE is encoded by the gadE-mdtEF operon, inducible by low pH [8] which is located in the region called the acid fitness island [21] Expression of gadE is controlled by an unusually large 798-bp upstream intergenic region, termed the sensory integration locus [15] At least six regulators related to the acid resistance system, GadE, GadX, GadW, EvgA, YdeO, and MnmE, are involved in the direct regulation of gadE [3, 15, 23] Ma et al.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GadE Functional   [IE] [1], [2], [3], [4], [5], [6], [7], [8]
Evolutionary Family: LuxR/UhpA
Connectivity class: Local Regulator
Gene name: gadE
  Genome position: 3658366-3658893
  Length: 528 bp / 175 aa
Operon name: gadEF-mdtEF
TU(s) encoding the TF:
Transcription unit        Promoter
gadE
gadEp1
gadE
gadEp3
gadE-mdtEF
gadEp4
gadEF-mdtEF
gadEp


Regulon       
Regulated gene(s) cyoA, cyoB, cyoC, cyoD, cyoE, fabZ, fliC, gadB, gadC, gadE, gadF, gadW, gadX, gltB, gltD, gltF, gnd, hdeA, hdeB, hdeD, lpxA, lpxD, lrp, mdtE, mdtF, purA, rcsA, skp, yhiD, yhiM, yjbQ, yjbR
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
membrane (7)
pH (6)
aerobic respiration (5)
Transcription related (5)
electron acceptors (4)
Read more >
Regulated operon(s) bamA-skp-lpxD-fabZ-lpxAB-rnhB-dnaE, cyoABCDE, fliC, gadAXW, gadBC, gadEF-mdtEF, gltBDF, gnd, hdeAB-yhiD, hdeD, lrp, purA, rcsA, yhiM, yjbQR
First gene in the operon(s) cyoA, fliC, gadB, gadE, gadE, gadX, gadX, gltB, gnd, hdeA, hdeD, skp, lrp, purA, rcsA, yhiM, yjbQ
Simple and complex regulons AdiY,ArgR,CRP,FNR,Fur,GadE,HdfR,IHF,Lrp,Nac
AdiY,CRP,Fis,FliZ,GadE,GadW,GadX,RcsB
ArcA,CRP,Cra,CusR,FNR,Fis,Fur,GadE,HprR,PdhR
ArcA,GadE,PhoP
CRP,EvgA,FliZ,GadE,GadW,GadX,H-NS,YdeO
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[GadE-RcsB,+](21)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  GadE activator cyoAp Sigma70 nd nd cyoA, cyoB, cyoC, cyoD, cyoE nd nd nd [GEA] [3]
  GadE activator fliCp Sigma28 nd nd fliC nd nd nd [GEA] [3]
  GadE activator gadBp Sigma38, Sigma70, Sigma38, Sigma70 -62.5 -89.5 gadB, gadC
ataaataacaTTAGGATTTTGTTATTTAAAcacgagtcct
1572125 1572144 nd [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [4], [9], [10], [11], [12], [13]
  GadE activator gadEp Sigma38 -198.5 -219.5 gadE, gadF, mdtE, mdtF
caaacgttaaCTTTTTGTTTGCTATTTACAagctgataac
3658137 3658156 nd [BPP], [GEA] [14]
  GadE activator gadEp Sigma38 -63.5 -84.5 gadE, gadF, mdtE, mdtF
taaagttcttATAGGCGTTTACTATATTGAacaacgattc
3658272 3658291 nd [APIORCISFBSCS], [BPP], [GEA] [13], [14]
  GadE activator gadEp Sigma38 -30.5 -51.5 gadE, gadF, mdtE, mdtF
acgattcggaCAAGGATGTAAATAATGAAAaggatgacat
3658305 3658324 nd [BPP], [GEA] [14]
  GadE activator gadEp1 Sigma38 nd nd gadE, gadF nd nd nd [GEA] [15]
  GadE activator gadXp Sigma38 nd nd gadX, gadW nd nd nd [BPP], [GEA] [3]
  GadE activator gltBp Sigma38, Sigma70 -284.0 -500.0 gltB, gltD, gltF
gcttatcttgTGTCAGATTTTTTTATCTCCtgatggattt
3354215 3354234 nd [BPP], , [GEA], [IHBCE], [3], [11]
  GadE activator gndp Sigma70 nd nd gnd nd nd nd [GEA] [3]
  GadE activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 -117.5 -168.5 hdeA, hdeB, yhiD
aatgcagtcgATTTAATAAAAATTTCCTAAttgcagtatc
3656899 3656918 nd [AIBSCS], [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [3], [10], [11], [13], [16]
  GadE activator hdeAp Sigma38, Sigma70, Sigma70, Sigma38 9.5 -42.5 hdeA, hdeB, yhiD
ataacctcagTGTCGAAATTGATTCGTGACggctctttca
3656773 3656792 nd , [IHBCE], [11]
  GadE activator hdeDp Sigma38, Sigma70 -51.5 -86.5 hdeD
gatactgcaaTTAGGAAATTTTTATTAAATcgactgcatt
3656899 3656918 nd [AIBSCS], [APIORCISFBSCS], [BPP], , [GEA], [IHBCE], [3], [10], [11], [13], [16]
  GadE activator hlpAp Sigma24 nd nd skp, lpxD, fabZ, lpxA nd nd nd [GEA] [3]
  GadE activator lrpp Sigma70 nd nd lrp nd nd nd [GEA] [3]
  GadE activator purAp Sigma70 nd nd purA nd nd nd [GEA] [3]
  GadE activator rcsAp Sigma70 nd nd rcsA nd nd nd [BPP], [GEA] [3]
  GadE activator yhiMp Sigma38 -78.5 -176.5 yhiM
gcataagaatTAATCTTAGGATAAATTTTTatttatcatg
3634655 3634674 nd , [IHBCE], [11]
  GadE activator yjbQp nd -40.0 -64.0 yjbQ, yjbR
cgaatgctgtTTTTTTAATCACACCTTTATcctttcgctg
4270164 4270183 nd , [IHBCE], [11]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  GadE activator hdeA gene -587.0 3656995 3657012 [1] nd [11]
  GadE activator hdeA gene -493.0 3656901 3656918 [1] nd [11]
  GadE activator hdeA gene -287.0 3657027 3657044 [1] nd [11]
  GadE activator hdeA gene -257.0 3656997 3657014 [1] nd [11]
  GadE activator gadB gene -80.0 1572125 1572142 [1] nd [11]
  GadE activator hdeB gene -11.0 3656303 3656320 [1] nd [11]
  GadE activator hdeD gene nd 3656995 3657012 [1] nd [11]
  GadE activator hdeA gene 6.0 3656734 3656751 [1] nd [11]
  GadE activator gadE gene 41.0 3658325 3658342 [1] nd [11]
  GadE activator gadE gene 59.0 3658307 3658324 [1] nd [11]
  GadE activator gadE gene 90.0 3658276 3658293 [1] nd [11]
  GadE activator hdeD gene 94.0 3656901 3656918 [1] nd [11]
  GadE activator gadE gene 182.0 3658184 3658201 [1] nd [11]
  GadE activator hdeD gene 540.0 3657027 3657044 [1] nd [11]
  GadE activator hdeD gene 570.0 3656997 3657014 [1] nd [11]
  GadE activator gadE gene 750.0 3658143 3658160 [1] nd [11]
  GadE activator hdeD gene 833.0 3656734 3656751 [1] nd [11]
  GadE activator gadE gene 861.0 3658032 3658049 [1] nd [11]
Other High-throughput regulatory interactions with weak evidence


Growth Condition    

 [1] 

C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| glucose 0.2%| aerobiosis| 37.0 C| pH 5.5| OD600 of 0.3| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| gadE knockout mutant| M9 minimal medium| glucose 0.2%| aerobiosis| 37.0 C| pH 5.5| OD600 of 0.3| mid exponential phase



Alignment and PSSM for GadE TFBSs    

Aligned TFBS of GadE   
  Sequence
  TTTAAATAACAAAATCCTAAGC
  TTTAAATAACAAAATCCTAATG
  ATTTAATAAAAATTTCCTAATT
  TTTCATTATTTACATCCTTGTC
  AGGAGATAAAAAAATCTGACAC
  TTTTTTTAATCACACCTTTATC
  TCAATATAGTAAACGCCTATAA
  CGTCACGAATCAATTTCGACAC
  TAAATAAAAATTTATCCTAAGA
  TGTAAATAGCAAACAAAAAGTT

Position weight matrix (PWM). GadE matrix-quality result   
A	2	1	2	6	6	7	1	10	7	3	6	9	6	6	1	1	1	1	8	5	3	2
C	1	1	0	2	0	1	0	0	0	3	2	0	2	2	1	8	7	0	0	2	0	5
G	0	3	1	0	1	0	1	0	2	0	0	0	0	0	1	0	0	2	0	2	2	1
T	7	5	7	2	3	2	8	0	1	4	2	1	2	2	7	1	2	7	2	1	5	2

Consensus   
;	consensus.strict             	tttaaatAacaAaatCCtaatc
;	consensus.strict.rc          	GATTAGGATTTTGTTATTTAAA
;	consensus.IUPAC              	tktawatAahaAaatCCtaawc
;	consensus.IUPAC.rc           	GWTTAGGATTTTDTTATWTAMA
;	consensus.regexp             	t[gt]ta[at]atAa[act]aAaatCCtaa[at]c
;	consensus.regexp.rc          	G[AT]TTAGGATTTT[AGT]TTAT[AT]TA[AC]A

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [IE] Inferred from experiment

 [GEA] Gene expression analysis

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [CEUMA] ChIP-exo evidence used in manual assertion

 [IHBCE] Inferred by a human based on computational evidence

 [RE] RNA-seq evidence

 [AIBSCS] Automated inference based on similarity to consensus sequences



Reference(s)    

 [1] Bordi C., Theraulaz L., Mejean V., Jourlin-Castelli C., 2003, Anticipating an alkaline stress through the Tor phosphorelay system in Escherichia coli., Mol Microbiol 48(1):211-23

 [2] Griffith JM., Basting PJ., Bischof KM., Wrona EP., Kunka KS., Tancredi AC., Moore JP., Hyman MRL., Slonczewski JL., 2019, Experimental Evolution of Escherichia coli K-12 in the Presence of Proton Motive Force (PMF) Uncoupler Carbonyl Cyanide m -Chlorophenylhydrazone Selects for Mutations Affecting PMF-Driven Drug Efflux Pumps., Appl Environ Microbiol 85(5)

 [3] Hommais F., Krin E., Coppee JY., Lacroix C., Yeramian E., Danchin A., Bertin P., 2004, GadE (YhiE): a novel activator involved in the response to acid environment in Escherichia coli., Microbiology 150(Pt 1):61-72

 [4] Ma Z., Gong S., Richard H., Tucker DL., Conway T., Foster JW., 2003, GadE (YhiE) activates glutamate decarboxylase-dependent acid resistance in Escherichia coli K-12., Mol Microbiol 49(5):1309-20

 [5] Masuda N., Church GM., 2002, Escherichia coli gene expression responsive to levels of the response regulator EvgA., J Bacteriol 184(22):6225-34

 [6] Masuda N., Church GM., 2003, Regulatory network of acid resistance genes in Escherichia coli., Mol Microbiol 48(3):699-712

 [7] Tatsuno I., Nagano K., Taguchi K., Rong L., Mori H., Sasakawa C., 2003, Increased adherence to Caco-2 cells caused by disruption of the yhiE and yhiF genes in enterohemorrhagic Escherichia coli O157:H7., Infect Immun 71(5):2598-606

 [8] Tucker DL., Tucker N., Conway T., 2002, Gene expression profiling of the pH response in Escherichia coli., J Bacteriol 184(23):6551-8

 [9] Castanie-Cornet MP., Foster JW., 2001, Escherichia coli acid resistance: cAMP receptor protein and a 20 bp cis-acting sequence control pH and stationary phase expression of the gadA and gadBC glutamate decarboxylase genes., Microbiology 147(Pt 3):709-15

 [10] Itou J., Eguchi Y., Utsumi R., 2009, Molecular mechanism of transcriptional cascade initiated by the EvgS/EvgA system in Escherichia coli K-12., Biosci Biotechnol Biochem 73(4):870-8

 [11] Seo SW., Kim D., O'Brien EJ., Szubin R., Palsson BO., 2015, Decoding genome-wide GadEWX-transcriptional regulatory networks reveals multifaceted cellular responses to acid stress in Escherichia coli., Nat Commun 6:7970

 [12] Tramonti A., De Canio M., Delany I., Scarlato V., De Biase D., 2006, Mechanisms of transcription activation exerted by GadX and GadW at the gadA and gadBC gene promoters of the glutamate-based acid resistance system in Escherichia coli., J Bacteriol 188(23):8118-27

 [13] Tucker DL., Tucker N., Ma Z., Foster JW., Miranda RL., Cohen PS., Conway T., 2003, Genes of the GadX-GadW regulon in Escherichia coli., J Bacteriol 185(10):3190-201

 [14] Ma Z., Masuda N., Foster JW., 2004, Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli., J Bacteriol 186(21):7378-89

 [15] Sayed AK., Foster JW., 2009, A 750 bp sensory integration region directs global control of the Escherichia coli GadE acid resistance regulator., Mol Microbiol 71(6):1435-50

 [16] Ruiz C., McMurry LM., Levy SB., 2008, Role of the multidrug resistance regulator MarA in global regulation of the hdeAB acid resistance operon in Escherichia coli., J Bacteriol 190(4):1290-7

 [17] Tramonti A, De Canio M, Bossa F, De Biase D, 2003, Stability and oligomerization of recombinant GadX, a transcriptional activator of the Escherichia coli glutamate decarboxylase system., Biochim Biophys Acta, 2003 Apr 11

 [18] Tramonti A., Visca P., De Canio M., Falconi M., De Biase D., 2002, Functional characterization and regulation of gadX, a gene encoding an AraC/XylS-like transcriptional activator of the Escherichia coli glutamic acid decarboxylase system., J Bacteriol 184(10):2603-13

 [19] Shin S, Castanie-Cornet MP, Foster JW, Crawford JA, Brinkley C, Kaper JB, 2001, An activator of glutamate decarboxylase genes regulates the expression of enteropathogenic Escherichia coli virulence genes through control of the plasmid-encoded regulator, Per., Mol Microbiol, 2001 Sep

 [20] Ma Z., Richard H., Tucker DL., Conway T., Foster JW., 2002, Collaborative regulation of Escherichia coli glutamate-dependent acid resistance by two AraC-like regulators, GadX and GadW (YhiW)., J Bacteriol 184(24):7001-12

 [21] Tramonti A., De Canio M., De Biase D., 2008, GadX/GadW-dependent regulation of the Escherichia coli acid fitness island: transcriptional control at the gadY-gadW divergent promoters and identification of four novel 42 bp GadX/GadW-specific binding sites., Mol Microbiol 70(4):965-82

 [22] Nishino K., Senda Y., Yamaguchi A., 2008, The AraC-family regulator GadX enhances multidrug resistance in Escherichia coli by activating expression of mdtEF multidrug efflux genes., J Infect Chemother 14(1):23-9

 [23] Sayed AK., Odom C., Foster JW., 2007, The Escherichia coli AraC-family regulators GadX and GadW activate gadE, the central activator of glutamate-dependent acid resistance., Microbiology 153(Pt 8):2584-92

 [24] Senda T, Ogawa N, 2005, [Structure function relationship of the LysR type transcriptional regulator]., Tanpakushitsu Kakusan Koso, 2005 Oct

 [25] Schell MA., 1993, Molecular biology of the LysR family of transcriptional regulators., Annu Rev Microbiol 47:597-626



RegulonDB