RegulonDB RegulonDB 10.10:Regulon Page

GntR DNA-binding transcriptional repressor

Synonyms: GntR, GntR-D-gluconate
The Gluconate repressor," GntR, is a transcription factor that negatively regulates the operon involved in the catabolism of D-gluconate via the Entner-Doudoroff pathway and also represses genes involved in two different systems related to D-gluconate uptake: gluconate I and gluconate II [3, 7, 8, 9]. This regulator is part of the gntRKU operon, yet it can also be constitutively expressed as an independent (gntR) transcription unit [1, 10]. Gluconate I is considered the main system for transport of D-gluconate and contains genes that encode high- and low-affinity gluconate transporters [4, 5, 8, 11, 12]. The D-gluconate II system is capable of transport of L-idonate and also is regulated by IdnR; the genes involved in this system encode another high-affinity gluconate transporter [3, 7, 8, 9]. In addition, the genes regulated are induced when Escherichia coli is grown in the presence of the inducer, D-gluconate, and in the absence of glucose.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GntR Functional   Apo [GEA], [IEP] [1]
GntR-D-gluconate Non-Functional Allosteric Holo [GEA], [IEP] [1]
Evolutionary Family: GalR/LacI
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: gntR
  Genome position: 3577731-3578726
  Length: 996 bp / 331 aa
Operon name: gntRKU
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) eda, edd, gntK, gntT, gntU, idnD, idnK, idnO, idnR, idnT, nfuA, yhgH
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (5)
Porters (Uni-, Sym- and Antiporters) (3)
membrane (3)
Entner-Doudoroff (2)
glyoxylate degradation (1)
Read more >
Regulated operon(s) edd-eda, gntRKU, gntT, idnDOTR, idnK, yhgH-nfuA
First gene in the operon(s) edd, gntK, gntT, yhgH, idnD, idnK
Simple and complex regulons CRP,GntR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  GntR repressor eddp Sigma70 -93.5 -202.5 edd, eda
1934797 1934816 [AIBSCS], [APIORCISFBSCS], [BPP] [2]
  GntR repressor eddp Sigma70 128.5 19.5 edd, eda
1934576 1934595 [APIORCISFBSCS], [BPP], [SM] [2]
  GntR repressor gntKp Sigma70 2.5 -51.5 gntK, gntU
3577634 3577653 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] [1], [3]
  GntR repressor gntKp Sigma70 15.5 -38.5 gntK, gntU
3577621 3577640 [GEA], [AIBSCS], [APIORCISFBSCS], [BPP], [SM] [3]
  GntR repressor gntTp1 Sigma70 -14.5 -168.5 gntT
3546381 3546400 [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] [4], [5], [6]
  GntR repressor gntTp1 Sigma70 127.5 -27.5 gntT
3546522 3546541 [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] [5], [6]
  GntR repressor gntTp2 nd -55.5 -168.5 gntT
3546381 3546400 [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] [4], [5], [6]
  GntR repressor gntTp2 nd 86.5 -27.5 gntT
3546522 3546541 [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] [5], [6]
  GntR repressor gntTp3 nd -58.5 -168.5 gntT
3546381 3546400 [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] [4], [5], [6]
  GntR repressor gntTp3 nd 83.5 -27.5 gntT
3546522 3546541 [GEA], [TASES], [AIBSCS], [APIORCISFBSCS], [BPP], [TASES] [5], [6]
  GntR repressor gntXp Sigma70 -15.0 -230.0 yhgH, nfuA
3544642 3544661 [AIBSCS]
  GntR repressor idnDp nd -108.5 -137.5 idnD, idnO, idnT, idnR
4494534 4494553 [GEA], [AIBSCS], [APIORCISFBSCS] [7]
  GntR repressor idnDp nd -78.5 -107.5 idnD, idnO, idnT, idnR
4494504 4494523 [GEA], [AIBSCS], [APIORCISFBSCS] [7]
  GntR repressor idnDp nd -58.5 -87.5 idnD, idnO, idnT, idnR
4494484 4494503 [GEA], [APIORCISFBSCS] [7]
  GntR repressor idnKp Sigma70 -103.5 -129.5 idnK
4494484 4494503 [GEA], [APIORCISFBSCS] [7]
  GntR repressor idnKp Sigma70 -83.5 -109.5 idnK
4494504 4494523 [GEA], [AIBSCS], [APIORCISFBSCS] [7]
  GntR repressor idnKp Sigma70 -53.5 -79.5 idnK
4494534 4494553 [GEA], [AIBSCS], [APIORCISFBSCS] [7]

Alignment and PSSM for GntR TFBSs    

Aligned TFBS of GntR   

Position weight matrix (PWM). GntR matrix-quality result   
A	5	2	0	1	2	8	1	0	0	1	0	7	7	1	9	2	4	4	1	3	9	5
C	2	3	0	0	1	0	5	5	6	0	1	1	0	7	0	0	1	1	3	3	0	0
G	0	0	9	1	0	0	0	2	2	7	0	0	0	0	0	1	0	1	3	1	0	0
T	2	4	0	7	6	1	3	2	1	1	8	1	2	1	0	6	4	3	2	2	0	4

;	consensus.strict             	acGttAccCGTaaCAtaagcAa
;	consensus.strict.rc          	TTGCTTATGTTACGGGTAACGT
;	consensus.IUPAC              	myGttAysSGTaaCAtwwsmAw
;	consensus.IUPAC.rc           	WTKSWWATGTTACSSRTAACRK
;	consensus.regexp             	[ac][ct]GttA[ct][cg][CG]GTaaCAt[at][at][cg][ac]A[at]
;	consensus.regexp.rc          	[AT]T[GT][CG][AT][AT]ATGTTAC[CG][CG][AG]TAAC[AG][GT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [1] Izu H., Adachi O., Yamada M., 1997, Gene organization and transcriptional regulation of the gntRKU operon involved in gluconate uptake and catabolism of Escherichia coli., J Mol Biol 267(4):778-93

 [2] Egan SE., Fliege R., Tong S., Shibata A., Wolf RE., Conway T., 1992, Molecular characterization of the Entner-Doudoroff pathway in Escherichia coli: sequence analysis and localization of promoters for the edd-eda operon., J Bacteriol 174(14):4638-46

 [3] Tsunedomi R., Izu H., Kawai T., Matsushita K., Ferenci T., Yamada M., 2003, The activator of GntII genes for gluconate metabolism, GntH, exerts negative control of GntR-regulated GntI genes in Escherichia coli., J Bacteriol 185(6):1783-95

 [4] Izu H., Kawai T., Yamada Y., Aoshima H., Adachi O., Yamada M., 1997, Characterization of the gntT gene encoding a high-affinity gluconate permease in Escherichia coli., Gene 199(1-2):203-10

 [5] Peekhaus N., Conway T., 1998, Positive and negative transcriptional regulation of the Escherichia coli gluconate regulon gene gntT by GntR and the cyclic AMP (cAMP)-cAMP receptor protein complex., J Bacteriol 180(7):1777-85

 [6] Peekhaus N., Conway T., 1998, What's for dinner?: Entner-Doudoroff metabolism in Escherichia coli., J Bacteriol 180(14):3495-502

 [7] Tsunedomi R., Izu H., Kawai T., Yamada M., 2003, Dual control by regulators, GntH and GntR, of the GntII genes for gluconate metabolism in Escherichia coli., J Mol Microbiol Biotechnol 6(1):41-56

 [8] Rodionov DA., Mironov AA., Rakhmaninova AB., Gelfand MS., 2000, Transcriptional regulation of transport and utilization systems for hexuronides, hexuronates and hexonates in gamma purple bacteria., Mol Microbiol 38(4):673-83

 [9] Bausch C., Peekhaus N., Utz C., Blais T., Murray E., Lowary T., Conway T., 1998, Sequence analysis of the GntII (subsidiary) system for gluconate metabolism reveals a novel pathway for L-idonic acid catabolism in Escherichia coli., J Bacteriol 180(14):3704-10

 [10] Tong S., Porco A., Isturiz T., Conway T., 1996, Cloning and molecular genetic characterization of the Escherichia coli gntR, gntK, and gntU genes of GntI, the main system for gluconate metabolism., J Bacteriol 178(11):3260-9

 [11] Porco A., Peekhaus N., Bausch C., Tong S., Isturiz T., Conway T., 1997, Molecular genetic characterization of the Escherichia coli gntT gene of GntI, the main system for gluconate metabolism., J Bacteriol 179(5):1584-90

 [12] Porco A., Alonso G., Isturiz T., 1998, The gluconate high affinity transport of GntI in Escherichia coli involves a multicomponent complex system., J Basic Microbiol 38(5-6):395-404
