![]() ![]() |
Synonyms: UxuR, UxuR-D-fructuronate, UxuR-α-D-glucuronate-α-D-galacturonate |
Summary:
The "hexuronate regulator," UxuR, is a transcriptional factor. This protein negatively regulates its own synthesis, and in the absence of fructuronate it represses transcription of the cluster of operons involved in transport and degradation of the sugar acids β-D-glucuronides, glucuronate, and gluconate [2, 3, 6, 7, 8]. This regulator is subject to catabolic repression in the presence of glucose and at low levels of cyclic AMP. Although little is known about the regulating mechanism of UxuR, it has been shown to act as a repressor, binding to a putative inverted repeat sequence from the uid operon in a cooperative process with UidR [1, 4]. In 1986, Blanco et al. proposed that total repression of UxuR is achieved in the presence of UidR, suggesting the possibility that UxuR and UidR form a complex. Independently, each repressor binds to DNA separately [1, 4]. On the other hand, UxuR is highly similar to ExuR (49% identity), and apparently both act together and are capable of cross talk to regulate expression of the uxuR regulon [7]. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||||||||
Evolutionary Family: | GntR | ||||||||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||||||||
Gene name: | uxuR | ||||||||||||||||||||||||
Genome position: | 4554576-4555349 | ||||||||||||||||||||||||
Length: | 774 bp / 257 aa | ||||||||||||||||||||||||
Operon name: | uxuR | ||||||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | exuR, gntP, lgoR, uidA, uidB, uidC, uxuA, uxuB, uxuR | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
carbon compounds (6)
Transcription related (2)
repressor (2)
Porters (Uni-, Sym- and Antiporters) (2)
membrane (2)
Read more >
|
||||||
Regulated operon(s) | exuR, gntP, lgoR, uidABC, uxuAB, uxuR | ||||||
First gene in the operon(s) | exuR, gntP, lgoR, uidA, uxuA, uxuR | ||||||
Simple and complex regulons | CRP,ExuR,OxyR,UxuR CRP,ExuR,UxuR CRP,OxyR,UxuR CRP,UidR,UxuR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
UxuR | repressor | exuRp2 | Sigma70 | -193.5 | -227.5 | exuR |
gcagttctggCAGTGTTCGACCTGTTAGgtgcgctggt
|
3246416 | 3246433 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [5] | |
UxuR | repressor | gntPp | Sigma70 | -130.5 | -168.5 | gntP |
ccgaattctgAAATTGGTTAACCACATCacaagaattt
|
4551456 | 4551473 | [APIORCISFBSCS], [CV(GEA)], [GEA] | [3], [6], [7] | |
UxuR | repressor | gntPp | Sigma70 | -24.5 | -62.5 | gntP |
attcatcgcaACAATGGTTGACCAATTTacataacata
|
4551350 | 4551367 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] | [7], [8] | |
UxuR | repressor | lgoRp4 | Sigma24 | 132.5 | 36.5 | lgoR |
tttacgccacAATGTGATTAACCAGGTCattgatgata
|
4595807 | 4595824 | [BPP], [GEA] | [9], [10] | |
UxuR | repressor | uidAp | nd | 28.5 | -53.5 | uidA, uidB, uidC |
gtgcaacacaGAATTGGTTAACTAATCAgattaaaggt
|
1696116 | 1696133 | [APIORCISFBSCS], [CV(GEA)], [GEA] | [1], [4], [7], [11] | |
UxuR | repressor | uxuAp | Sigma70 | -159.5 | -277.5 | uxuA, uxuB |
tatgttatgtAAATTGGTCAACCATTGTtgcgatgaat
|
4551350 | 4551367 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] | [7], [8] | |
UxuR | repressor | uxuAp | Sigma70 | -53.5 | -171.5 | uxuA, uxuB |
aaattcttgtGATGTGGTTAACCAATTTcagaattcgg
|
4551456 | 4551473 | [APIORCISFBSCS], [CV(GEA)], [GEA] | [3], [6], [7], [12] | |
UxuR | repressor | uxuRp | Sigma70 | -66.5 | -184.5 | uxuR |
ccctacagacTTACTGGTCAATCAAACTgatatttggt
|
4554383 | 4554400 | [AIBSCS] | [13] | |
UxuR | repressor | uxuRp | Sigma70 | -46.5 | -164.5 | uxuR |
atcaaactgaTATTTGGTTGACCAGTTTtcgttttttt
|
4554403 | 4554420 | [AIBSCS], [CV(GEA)], [GEA] | [7], [12], [13] | |
UxuR | repressor | uxuRp | Sigma70 | 93.5 | -25.5 | uxuR |
atccggcaaaAATTTGATTAACCGCACCtaacggacac
|
4554542 | 4554559 | [AIBSCS], [CV(GEA)], [GEA] | [13] |
Functional conformation | Function | Object name | Object type | Distance to first Gene | Sequence | LeftPos | RightPos | Center Position | Growth Condition | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
UxuR | repressor | yjjN | tu | nd |
tttacgccacAATGTGATTAACCAGGTCattgatgata
|
4595807 | 4595824 | 4595815.5 | nd | [BPP], [GEA] | [9], [10] |
Alignment and PSSM for UxuR TFBSs | ![]() |
---|
Aligned TFBS of UxuR |
---|
Sequence | |
---|---|
ACTGGTCAACCAAATATCAGT | |
TGCGGTTAATCAAATTTTTGC | |
ACTGGTCAATCAAACTGATAT | |
CCTGGTTAATCACATTGTGGC | |
ATTAGTTAACCAATTCTGTGT | |
TGTGGTTAACCAATTTCAGAA | |
ATTGGTCAACCATTGTTGCGA | |
AGTGTTCGACCTGTTAGGTGC |
Position weight matrix (PWM). UxuR matrix-quality result |
---|
A 5 0 0 1 0 0 0 7 8 0 0 7 5 4 0 2 0 2 1 2 2 C 1 3 1 0 0 0 4 0 0 5 8 0 1 0 1 1 1 1 1 0 3 G 0 3 0 7 7 0 0 1 0 0 0 0 1 0 1 0 3 3 2 6 0 T 2 2 7 0 1 8 4 0 0 3 0 1 1 4 6 5 4 2 4 0 3 |
Consensus |
---|
; consensus.strict agTGGTcAACCAaattggtGc ; consensus.strict.rc GCACCAATTTGGTTGACCACT ; consensus.IUPAC asTGGTyAAYCAawttkgkGy ; consensus.IUPAC.rc RCMCMAAWTTGRTTRACCAST ; consensus.regexp a[cg]TGGT[ct]AA[CT]CAa[at]tt[gt]g[gt]G[ct] ; consensus.regexp.rc [AG]C[AC]C[AC]AA[AT]TTG[AG]TT[AG]ACCA[CG]T |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|