RegulonDB RegulonDB 11.1:Regulon Page

YdeO DNA-binding transcriptional dual regulator

Synonyms: YdeO
YdeO belongs to the AraC/XylS family of transcriptional regulators and shows more similarity to YhiW, AppY, AdiY, and GadX than the other AraC/XylS regulators [5, 6]. The members of this family exhibit two domains, an amino-terminal domain involved in coinducer recognition and dimerization and a carboxy-terminal domain that contains a potential helix-turn-helix DNA-binding motif [5, 7]. YdeO activates genes involved in the cellular response to acid resistance [2, 8, 9]. This protein, together with the proteins HNS, EvgA, and GadE, pertains to a specific regulatory circuit that is functional in exponential-phase cells growing in minimal medium [2, 8, 9]. Several of the genes directly regulated by YdeO are also directly regulated by GadX [9]. The YdeO regulon has been determined [1].
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
YdeO Functional   nd nd nd
Evolutionary Family: AraC/XylS
TFBs symmetry: inverted-repeat
Connectivity class: Local Regulator
Gene name: ydeO
  Genome position: 1582926-1583687
  Length: 762 bp / 253 aa
Operon name: safA-ydeO
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) appA, appB, appC, appX, dctR, gadE, gadF, gadW, hyaA, hyaB, hyaC, hyaD, hyaE, hyaF, mdtE, mdtF, safA, slp, uspD, ydeO, yiiS
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
aerobic respiration (6)
anaerobic respiration (6)
membrane (5)
Transcription related (3)
electron donors (3)
Read more >
Regulated operon(s) appCBXA, gadAXW, gadEF-mdtEF, hyaABCDEF, safA-ydeO, slp-dctR, yiiS-uspD
First gene in the operon(s) appC, gadE, gadW, hyaA, safA, slp, yiiS
Simple and complex regulons AppY,ArcA,Fis,IscR,NarL,NarP,YdeO
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  YdeO activator appCp Sigma70 -27.5 -57.5 appC, appB, appX, appA
  YdeO activator appCp2 Sigma38 -27.5 -57.5 appC, appB, appX, appA
  YdeO activator gadEp2 Sigma38 nd nd gadE, gadF, mdtE, mdtF nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS], [EXP-IDA-BINDING-OF-PURIFIED-PROTEINS] W [2]
  YdeO activator gadEp3 Sigma70 -41.0 -607.0 gadE, gadF
  YdeO activator gadWp1 nd -13.0 -46.0 gadW
  YdeO activator hyaAp Sigma70 -61.0 -216.0 hyaA, hyaB, hyaC, hyaD, hyaE, hyaF
  YdeO activator hyaAp2 Sigma38 -61.0 -216.0 hyaA, hyaB, hyaC, hyaD, hyaE, hyaF
  YdeO repressor safAp Sigma70 nd nd safA, ydeO nd nd [EXP-IEP-GENE-EXPRESSION-ANALYSIS] W [4]
  YdeO activator slpp Sigma70 -40.0 -65.0 slp, dctR
  YdeO activator yiiSp Sigma24 -55.0 -153.0 yiiS, uspD

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence Confidence level (C: Confirmed, S: Strong, W: Weak) References
  YdeO activator nhaR Transcription-Unit nd

Alignment and PSSM for YdeO TFBSs    

Aligned TFBS of YdeO   

Position weight matrix (PWM). YdeO matrix-quality result   
A	1	1	1	0	5	1	0	0	1	1	5	1	0	5	0	2	3	3	3	6	0	1	2	3	4	3	2	2	1	2	0
C	0	0	2	3	0	0	0	1	2	3	1	1	2	0	1	0	3	0	1	0	0	0	0	2	0	0	0	2	2	2	5
G	2	2	1	1	0	1	0	0	0	0	0	2	3	1	0	1	0	0	2	0	3	5	2	1	1	1	1	0	1	1	0
T	3	3	2	2	1	4	6	5	3	2	0	2	1	0	5	3	0	3	0	0	3	0	2	0	1	2	3	2	2	1	1

;	consensus.strict             	ttccatTttcaggattcaaAgGgaaatcccC
;	consensus.strict.rc          	GGGGATTTCCCTTTGAATCCTGAAAATGGAA
;	consensus.IUPAC              	kkyyatTtyyaksatwmwrAkGdmawwhymC
;	consensus.regexp             	[gt][gt][ct][ct]atTt[ct][ct]a[gt][cg]at[at][ac][at][ag]A[gt]G[agt][ac]a[at][at][act][ct][ac]C
;	consensus.regexp.rc          	G[GT][AG][AGT][AT][AT]T[GT][ACT]C[AC]T[CT][AT][GT][AT]AT[CG][AC]T[AG][AG]AAAT[AG][AG][AC][AC]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation


 [1] Yamanaka Y., Oshima T., Ishihama A., Yamamoto K., 2014, Characterization of the YdeO regulon in Escherichia coli., PLoS One 9(11):e111962

 [2] Ma Z., Masuda N., Foster JW., 2004, Characterization of EvgAS-YdeO-GadE branched regulatory circuit governing glutamate-dependent acid resistance in Escherichia coli., J Bacteriol 186(21):7378-89

 [3] Sayed AK., Foster JW., 2009, A 750 bp sensory integration region directs global control of the Escherichia coli GadE acid resistance regulator., Mol Microbiol 71(6):1435-50

 [4] Burton NA., Johnson MD., Antczak P., Robinson A., Lund PA., 2010, Novel aspects of the acid response network of E. coli K-12 are revealed by a study of transcriptional dynamics., J Mol Biol 401(5):726-42

 [5] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [6] Ibarra JA, Pérez-Rueda E, Segovia L, Puente JL, 2008, The DNA-binding domain as a functional indicator: the case of the AraC/XylS family of transcription factors., Genetica, 133(1):65 10.1007/s10709-007-9185-y

 [7] Martin RG, Rosner JL, 2001, The AraC transcriptional activators., Curr Opin Microbiol, 4(2):132 10.1016/s1369-5274(00)00178-8

 [8] Masuda N., Church GM., 2002, Escherichia coli gene expression responsive to levels of the response regulator EvgA., J Bacteriol 184(22):6225-34

 [9] Masuda N., Church GM., 2003, Regulatory network of acid resistance genes in Escherichia coli., Mol Microbiol 48(3):699-712

 [10] Eguchi Y., Itou J., Yamane M., Demizu R., Yamato F., Okada A., Mori H., Kato A., Utsumi R., 2007, B1500, a small membrane protein, connects the two-component systems EvgS/EvgA and PhoQ/PhoP in Escherichia coli., Proc Natl Acad Sci U S A 104(47):18712-7

 [11] Yamanaka Y, Ishihama A, Yamamoto K, 2012, Induction of YdeO, a regulator for acid resistance genes, by ultraviolet irradiation in Escherichia coli., Biosci Biotechnol Biochem, 76(6):1236 10.1271/bbb.120041
