RegulonDB RegulonDB 10.6.3:Regulon Page

AraC DNA-binding transcriptional dual regulator

Synonyms: AraC, AraC-arabinose, AraC-D-fucose
The "arabinose regulator," AraC, is a transcription factor that regulates transcription of several genes and operons involved in arabinose catabolism and transport. It coregulates with another transcriptional regulator, CRP; both are transcription factors involved in l-arabinose degradation. These regulators bind cooperatively to activate transcription of five operons related to transport, catabolism, and autoregulation of l-arabinose. Transcription of these operons is induced when E. coli is grown in the absence of glucose and when the physiological inducer, l-arabinose, binds to the AraC regulator. In the absence of glucose, cellular cyclic AMP levels are high and cyclic AMP forms a dimeric complex with CRP to coregulate with AraC [2, 9, 14, 18, 21, 24, 25] AraC binds to five target sites in the araBp region. AraC binds to the less-conserved site (-42.5) with less strength; this binding occurs only in the presence of arabinose, and it is absolutely required for expression of araBp [7, 26, 27, 28, 29] AraC binding to the distal site (-123.5) has been shown to down-regulate expression of araBp and araCp [6, 27] In the absence of arabinose, AraC is unable to activate araBp, but it regulates its own expression by repressing araCp and araBp simultaneously [26, 27, 28] Arabinose triggers AraC-dependent activation of araBp and relieves AraC-dependent repression of araCp [27, 28] The araBAD operon is located upstream of araC and in the opposite direction. In the presence of arabinose, this regulator activates transcription by overlapping the -35 box of the core promoters, and the central position of the binding site is located near bp -41.5.
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
AraC Functional   Apo [BPP], [IDA], [IPI], [SM] [1], [2], [3], [4], [5], [6], [7], [8], [9], [10], [11]
AraC-D-fucose Non-Functional Allosteric Holo [IPI] [11]
AraC-arabinose Functional Allosteric Holo [APPH], [BPP], [IDA], [IEP], [IPI], [SM] [1], [2], [3], [4], [5], [6], [7], [8], [9], [10], [11], [12], [13]
Evolutionary Family: AraC/XylS
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: araC
  Genome position: 70387-71265
  Length: 879 bp / 292 aa
Operon name: araC
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) araA, araB, araC, araD, araE, araF, araG, araH, araJ, xylA, xylB, ydeM, ydeN, ygeA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (11)
membrane (3)
Porters (Uni-, Sym- and Antiporters) (2)
Transcription related (1)
activator (1)
Read more >
Regulated operon(s) araBAD, araC, araE-ygeA, araFGH, araJ, xylAB, ydeNM
First gene in the operon(s) araB, araC, araE, araE, araF, araJ, xylA, ydeN
Simple and complex regulons AraC,CRP
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  AraC repressor araBp Sigma70 -275.0 -302.0 araB, araA, araD
70342 70358 [BCE], [BPP], [HIBSCS], [SM] [3], [9], [12], [14], [15], [16], [17]
  AraC-arabinose repressor araBp Sigma70 -138.0 -165.0 araB, araA, araD
70205 70221 [BCE], [GEA], [HIBSCS], [SM] [6], [14], [16]
  AraC-arabinose repressor araBp Sigma70 -117.0 -144.0 araB, araA, araD
70184 70200 [BCE], [GEA], [HIBSCS], [SM] [6], [14], [16]
  AraC dual araBp Sigma70 -64.0 -91.0 araB, araA, araD
70131 70147 [BPP], [GEA], [HIBSCS], [SM] [1], [9], [12], [13], [14], [15], [16], [17]
  AraC-arabinose dual araBp Sigma70 -64.0 -91.0 araB, araA, araD
70131 70147 [BPP], [GEA], [HIBSCS], [SM] [1], [9], [12], [13], [14], [15], [16], [17]
  AraC-arabinose activator araBp Sigma70 -43.0 -70.0 araB, araA, araD
70110 70126 [BPP], [GEA], [HIBSCS], [SM] [1], [3], [7], [9], [12], [13], [14], [17]
  AraC-arabinose activator araCp Sigma70 -123.0 -269.0 araC
70110 70126 [BPP], [GEA], [HIBSCS], [SM] [1], [3], [7], [12], [13], [14]
  AraC dual araCp Sigma70 -102.0 -248.0 araC
70131 70147 [BPP], [GEA], [HIBSCS], [SM] [1], [12], [13], [14], [15], [16]
  AraC-arabinose dual araCp Sigma70 -102.0 -248.0 araC
70131 70147 [BPP], [GEA], [HIBSCS], [SM] [1], [12], [13], [14], [15], [16]
  AraC-arabinose repressor araCp Sigma70 -49.0 -195.0 araC
70184 70200 [BCE], [GEA], [HIBSCS], [SM] [6], [14], [16]
  AraC-arabinose repressor araCp Sigma70 -28.0 -174.0 araC
70205 70221 [BCE], [GEA], [HIBSCS], [SM] [6], [14], [16]
  AraC repressor araCp Sigma70 110.0 -37.0 araC
70342 70358 [BCE], [BPP], [HIBSCS], [SM] [3], [9], [12], [14], [15], [16]
  AraC-arabinose activator araEp Sigma70 -65.0 -91.0 araE, ygeA
2982265 2982281 [BPP], [HIBSCS] [14], [18]
  AraC-arabinose activator araEp Sigma70 -44.0 -70.0 araE, ygeA
2982244 2982260 [BPP], [HIBSCS] [14], [18]
  AraC-arabinose activator araFp Sigma70, Sigma38 -166.0 -276.0 araF, araG, araH
1986396 1986412 [BPP], [SM] [2], [14], [19]
  AraC-arabinose activator araFp Sigma70, Sigma38 -145.0 -255.0 araF, araG, araH
1986375 1986391 [AIBSCS], [BPP], [HIBSCS] [2], [4], [14], [19]
  AraC-arabinose activator araFp Sigma70, Sigma38 -91.0 -201.0 araF, araG, araH
1986321 1986337 [BPP], [SM] [2], [14], [19]
  AraC-arabinose activator araFp Sigma70, Sigma38 -70.0 -180.0 araF, araG, araH
1986300 1986316 [BPP], [HIBSCS] [2], [4], [19], [20]
  AraC-arabinose activator araJp Sigma70 -64.0 -112.0 araJ
412585 412601 [BPP], [HIBSCS] [2], [14], [21]
  AraC-arabinose activator araJp Sigma70 -43.0 -91.0 araJ
412564 412580 [AIBSCS], [BPP] [2], [14], [21]
  AraC-arabinose repressor xylAp nd -48.0 -90.0 xylA, xylB
3730847 3730863 [BCE], [GEA], [HIBSCS] [22]
  AraC-arabinose repressor xylAp nd -25.0 -67.0 xylA, xylB
3730824 3730840 [BCE], [GEA] [22]
  AraC-arabinose repressor ydeNp Sigma70 nd nd ydeN, ydeM nd nd [GEA] [23]

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  AraC repressor nd nd nd 4449772 4449791 nd [AIBSCS], [GEA], [SM] [23]

Alignment and PSSM for AraC TFBSs    

Aligned TFBS of AraC   

Position weight matrix (PWM). AraC matrix-quality result   
A	4	7	1	11	3	2	6	5	5	9	6	8	6	2	3	2	12	0	11	9
C	6	2	7	0	0	8	5	1	0	0	0	3	3	1	9	12	2	1	1	1
G	1	3	2	2	11	1	3	6	8	1	1	1	5	1	3	0	0	0	2	0
T	4	3	5	2	1	4	1	3	2	5	8	3	1	11	0	1	1	14	1	5

;	consensus.strict             	cacaGccggatagtCCaTaa
;	consensus.strict.rc          	TTATGGACTATCCGGCTGTG
;	consensus.IUPAC              	cayaGcmrrwwartCCaTaw
;	consensus.IUPAC.rc           	WTATGGAYTWWYYKGCTRTG
;	consensus.regexp             	ca[ct]aGc[ac][ag][ag][at][at]a[ag]tCCaTa[at]
;	consensus.regexp.rc          	[AT]TATGGA[CT]T[AT][AT][CT][CT][GT]GCT[AG]TG

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [BPP] Binding of purified proteins

 [IDA] Inferred from direct assay

 [IPI] Inferred from physical interaction

 [SM] Site mutation

 [APPH] Assay of protein purified to homogeneity

 [IEP] Inferred from expression pattern

 [BCE] Binding of cellular extracts

 [HIBSCS] Human inference based on similarity to consensus sequences

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences


 [1] Bustos SA., Schleif RF., 1993, Functional domains of the AraC protein., Proc Natl Acad Sci U S A 90(12):5638-42

 [2] Hendrickson W., Stoner C., Schleif R., 1990, Characterization of the Escherichia coli araFGH and araJ promoters., J Mol Biol 215(4):497-510

 [3] Huo L., Martin KJ., Schleif R., 1988, Alternative DNA loops regulate the arabinose operon in Escherichia coli., Proc Natl Acad Sci U S A 85(15):5444-8

 [4] Johnson CM., Schleif RF., 1995, In vivo induction kinetics of the arabinose promoters in Escherichia coli., J Bacteriol 177(12):3438-42

 [5] LaRonde-LeBlanc N, Wolberger C., 2000, Characterization of the oligomeric states of wild type and mutant AraC., Biochemistry.

 [6] Lee DH., Huo L., Schleif R., 1992, Repression of the araBAD promoter from araO1., J Mol Biol 224(2):335-41

 [7] Lee N., Francklyn C., Hamilton EP., 1987, Arabinose-induced binding of AraC protein to araI2 activates the araBAD operon promoter., Proc Natl Acad Sci U S A 84(24):8814-8

 [8] Ross JJ, Gryczynski U, Schleif R., 2003, Mutational analysis of residue roles in AraC function., J Mol Biol.

 [9] Seabold RR., Schleif RF., 1998, Apo-AraC actively seeks to loop., J Mol Biol 278(3):529-38

 [10] Soisson SM, MacDougall-Shackleton B, Schleif R, Wolberger C, 1997, Structural basis for ligand-regulated oligomerization of AraC., Science, 1997 Apr 18

 [11] Weldon JE, Rodgers ME, Larkin C, Schleif RF., 2007, Structure and properties of a truely apo form of AraC dimerization domain., Proteins

 [12] Niland P., Huhne R., Muller-Hill B., 1996, How AraC interacts specifically with its target DNAs., J Mol Biol 264(4):667-74

 [13] Reeder T., Schleif R., 1993, AraC protein can activate transcription from only one position and when pointed in only one direction., J Mol Biol 231(2):205-18

 [14] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [15] Lee DH., Schleif RF., 1989, In vivo DNA loops in araCBAD: size limits and helical repeat., Proc Natl Acad Sci U S A 86(2):476-80

 [16] Lee NL., Gielow WO., Wallace RG., 1981, Mechanism of araC autoregulation and the domains of two overlapping promoters, Pc and PBAD, in the L-arabinose regulatory region of Escherichia coli., Proc Natl Acad Sci U S A 78(2):752-6

 [17] Lobell RB., Schleif RF., 1991, AraC-DNA looping: orientation and distance-dependent loop breaking by the cyclic AMP receptor protein., J Mol Biol 218(1):45-54

 [18] Stoner C., Schleif R., 1983, The araE low affinity L-arabinose transport promoter. Cloning, sequence, transcription start site and DNA binding sites of regulatory proteins., J Mol Biol 171(4):369-81

 [19] Lu Y., Flaherty C., Hendrickson W., 1992, AraC protein contacts asymmetric sites in the Escherichia coli araFGH promoter., J Biol Chem 267(34):24848-57

 [20] Johnson CM., Schleif RF., 2000, Cooperative action of the catabolite activator protein and AraC in vitro at the araFGH promoter., J Bacteriol 182(7):1995-2000

 [21] Reeder T., Schleif R., 1991, Mapping, sequence, and apparent lack of function of araJ, a gene of the Escherichia coli arabinose regulon., J Bacteriol 173(24):7765-71

 [22] Desai TA., Rao CV., 2009, Regulation of arabinose and xylose metabolism in Escherichia coli., Appl Environ Microbiol

 [23] Stringer AM., Currenti S., Bonocora RP., Baranowski C., Petrone BL., Palumbo MJ., Reilly AA., Zhang Z., Erill I., Wade JT., 2014, Genome-scale analyses of Escherichia coli and Salmonella enterica AraC reveal noncanonical targets and an expanded core regulon., J Bacteriol 196(3):660-71

 [24] Hendrickson W., Flaherty C., Molz L., 1992, Sequence elements in the Escherichia coli araFGH promoter., J Bacteriol 174(21):6862-71

 [25] Miyada CG., Stoltzfus L., Wilcox G., 1984, Regulation of the araC gene of Escherichia coli: catabolite repression, autoregulation, and effect on araBAD expression., Proc Natl Acad Sci U S A 81(13):4120-4

 [26] Lobell RB, Schleif RF, 1990, DNA looping and unlooping by AraC protein., Science, 1990 Oct 26

 [27] Hamilton EP., Lee N., 1988, Three binding sites for AraC protein are required for autoregulation of araC in Escherichia coli., Proc Natl Acad Sci U S A 85(6):1749-53

 [28] Martin K, Huo L, Schleif RF, 1986, The DNA loop model for ara repression: AraC protein occupies the proposed loop sites in vivo and repression-negative mutations lie in these same sites., Proc Natl Acad Sci U S A, 1986 Jun

 [29] Carra JH, Schleif RF, 1993, Variation of half-site organization and DNA looping by AraC protein., EMBO J, 1993 Jan

 [30] Rodgers ME, Schleif R, 2009, Solution structure of the DNA binding domain of AraC protein., Proteins, 2009 Oct

 [31] Gallegos MT, Michán C, Ramos JL, 1993, The XylS/AraC family of regulators., Nucleic Acids Res, 1993 Feb 25

 [32] Cole SD, Schleif R, 2012, A new and unexpected domain-domain interaction in the AraC protein., Proteins, 2012 May

 [33] Soisson SM, MacDougall-Shackleton B, Schleif R, Wolberger C, 1997, The 1.6 A crystal structure of the AraC sugar-binding and dimerization domain complexed with D-fucose., J Mol Biol, 1997 Oct 17

 [34] Rodgers ME, Holder ND, Dirla S, Schleif R, 2009, Functional modes of the regulatory arm of AraC., Proteins, 2009 Jan

 [35] Seedorff J, Schleif R, 2011, Active role of the interdomain linker of AraC., J Bacteriol, 2011 Oct

 [36] Malaga F, Mayberry O, Park DJ, Rodgers ME, Toptygin D, Schleif RF, 2016, A genetic and physical study of the interdomain linker of E. Coli AraC protein--a trans-subunit communication pathway., Proteins, 2016 Apr
