![]() ![]() |
Synonyms: RhaS-α-L-rhamnopyranose, RhaS, RhaS-L-rhamnose |
Summary:
The "Rhamnose regulator," RhaS, is a transcription factor involved in L-rhamnose degradation and transport [1, 9, 13]. RhaS alone is able to activate transcription of rha operons, but in the presence of CRP, transcription increases. On the other hand, CRP alone is unable to activate transcription of rha operons in the absence of RhaS. Therefore, these two regulators bind cooperatively to fully activate the operons related with transport and degradation of L-rhamnose [1, 10, 13, 15]. Additionally, synthesis of rha operons is induced when E. coli is grown on L-rhamnose in the absence of glucose and when cellular cyclic AMP levels are high [15]. RhaS is part of the unusual rhaSR operon that encodes two transcriptional regulators, RhaS and RhaR (30% identical), both members of the AraC/XylS family of transcriptional regulators [5]. Apparently, expression of operons involved in transport and degradation of L-rhamnose first requires expression of RhaR, which induces transcription of the rhaSR operon. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||||||||
Evolutionary Family: | AraC/XylS | ||||||||||||||||||||||||
Sensing class: | External sensing using transported metabolites | ||||||||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||||||||
Gene name: | rhaS | ||||||||||||||||||||||||
Genome position: | 4097736-4098572 | ||||||||||||||||||||||||
Length: | 837 bp / 278 aa | ||||||||||||||||||||||||
Operon name: | rhaSR | ||||||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | rhaA, rhaB, rhaD, rhaR, rhaS, rhaT | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
carbon compounds (6)
Transcription related (2)
activator (2)
operon (2)
Porters (Uni-, Sym- and Antiporters) (1)
|
||||||
Regulated operon(s) | rhaBAD, rhaSR, rhaT | ||||||
First gene in the operon(s) | rhaB, rhaS, rhaT | ||||||
Simple and complex regulons | ArcA,CRP,RhaS CRP,RhaR,RhaS CRP,RhaS | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence![]() |
LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
RhaS-L-rhamnose | activator | rhaBp | Sigma70 | -73.0 | -97.0 | rhaB, rhaA, rhaD |
catcacgttcATCTTTCCCTGGTTGCCaatggcccat
|
4097537 | 4097553 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] | [1], [5], [7], [8], [9], [10], [11] | |
RhaS-L-rhamnose | activator | rhaBp | Sigma70 | -40.0 | -64.0 | rhaB, rhaA, rhaD |
ccattttcctGTCAGTAACGAGAAGGTcgcgaattca
|
4097504 | 4097520 | [APIORCISFBSCS], [BCE], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] | [1], [5], [7], [8], [9], [10], [11] | |
RhaS-L-rhamnose | activator | rhaSp | Sigma70, Sigma38 | -74.0 | -99.0 | rhaS, rhaR |
ttcacgctgtATCTTGAAAAATCGACGttttttacgt
|
4097629 | 4097645 | [BPP], [GEA] | [1], [12] | |
RhaS-L-rhamnose | activator | rhaSp | Sigma70, Sigma38 | -40.0 | -65.0 | rhaS, rhaR |
cgtggttttcCGTCGAAAATTTAAGGTaagaacctga
|
4097663 | 4097679 | [BPP], [GEA] | [1], [12] | |
RhaS | unknown | rhaSp | Sigma70, Sigma38 | 915.0 | 890.0 | rhaS, rhaR |
gcgaataatcAACTTCGTTCTCTGGCCGaggtagccac
|
4098617 | 4098634 | [APIORCISFBSCS], [BPP] | [8] | |
RhaS | unknown | rhaTp | Sigma70 | -499.0 | -540.0 | rhaT |
cttttttcagACCTTTCCAGAACAGGCtgtggttagc
|
4101057 | 4101073 | [APIORCISFBSCS], [BPP] | [8] | |
RhaS-L-rhamnose | activator | rhaTp | Sigma70 | -74.0 | -115.0 | rhaT |
aatcacccacTTAATGCCGTGATTGCCagtaaatcga
|
4100632 | 4100648 | [AIBSCS], [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] | [8], [13] | |
RhaS-L-rhamnose | activator | rhaTp | Sigma70 | -41.0 | -82.0 | rhaT |
tcgacaacggCGGCAACAGGCGAAAGGttaatcgaca
|
4100599 | 4100615 | [AIBSCS], [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [8], [13], [14] |
Alignment and PSSM for RhaS TFBSs | ![]() |
---|
Aligned TFBS of RhaS |
---|
Sequence | |
---|---|
CTGGCAATCACGGCATTAAG | |
TTGGCAACCAGGGAAAGATG | |
CTTTCCAGAACAGGCTGTGG | |
ACGGCGGCAACAGGCGAAAG | |
CTGTCAGTAACGAGAAGGTC | |
ACCTCGGCCAGAGAACGAAG | |
TTTTCCGTCGAAAATTTAAG | |
CTTGAAAAATCGACGTTTTT |
Position weight matrix (PWM). RhaS matrix-quality result |
---|
A 2 0 0 0 1 4 4 1 4 6 1 4 3 3 4 2 1 5 4 0 C 4 2 1 0 7 2 0 3 4 0 5 0 0 2 2 1 0 0 0 1 G 0 0 4 4 0 2 4 1 0 1 2 4 5 3 1 1 4 1 1 6 T 2 6 3 4 0 0 0 3 0 1 0 0 0 0 1 4 3 2 3 1 |
Consensus |
---|
; consensus.strict ctggCagccaCgGgatgaaG ; consensus.strict.rc CTTCATCCCGTGGCTGCCAG ; consensus.IUPAC cykkCvrymaSrRvmtkawG ; consensus.IUPAC.rc CWTMAKBYYSTKRYBGMMRG ; consensus.regexp c[ct][gt][gt]C[acg][ag][ct][ac]a[CG][ag][AG][acg][ac]t[gt]a[at]G ; consensus.regexp.rc C[AT]T[AC]A[GT][CGT][CT][CT][CG]T[GT][AG][CT][CGT]G[AC][AC][AG]G |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|