RegulonDB RegulonDB 10.7:Regulon Page
   

RhaS DNA-binding transcriptional activator

Synonyms: RhaS-;-L-rhamnopyranose, RhaS, RhaS-L-rhamnose, RhaS-α-L-rhamnopyranose
Summary:
The "Rhamnose regulator," RhaS, is a transcription factor involved in L-rhamnose degradation and transport [1, 9, 13]. RhaS alone is able to activate transcription of rha operons, but in the presence of CRP, transcription increases. On the other hand, CRP alone is unable to activate transcription of rha operons in the absence of RhaS. Therefore, these two regulators bind cooperatively to fully activate the operons related with transport and degradation of L-rhamnose [1, 10, 13, 15]. Additionally, synthesis of rha operons is induced when E. coli is grown on L-rhamnose in the absence of glucose and when cellular cyclic AMP levels are high [15]. RhaS is part of the unusual rhaSR operon that encodes two transcriptional regulators, RhaS and RhaR (30% identical), both members of the AraC/XylS family of transcriptional regulators [5, 16]. Apparently, expression of operons involved in transport and degradation of L-rhamnose first requires expression of RhaR, which induces transcription of the rhaSR operon.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
RhaS Functional   Apo nd [1], [2], [3]
RhaS-α-L-rhamnopyranose Functional Allosteric Holo [GEA] [4]
RhaS-;-L-rhamnopyranose Functional Allosteric Holo [GEA], [SM] [4]
RhaS-L-rhamnose Functional   Holo [APPH], [GEA], [HIFS], [IEP], [IMP], [IPI], [SM] [4], [5], [6], [7], [8]
Evolutionary Family: AraC/XylS
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: rhaS
  Genome position: 4097736-4098572
  Length: 837 bp / 278 aa
Operon name: rhaSR
TU(s) encoding the TF:
Transcription unit        Promoter
rhaSR
rhaSp


Regulon       
Regulated gene(s) rhaA, rhaB, rhaD, rhaR, rhaS, rhaT
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (6)
Transcription related (2)
activator (2)
operon (2)
Porters (Uni-, Sym- and Antiporters) (1)
Regulated operon(s) rhaBAD, rhaSR, rhaT
First gene in the operon(s) rhaB, rhaS, rhaT
Simple and complex regulons ArcA,CRP,RhaS
CRP,RhaR,RhaS
CRP,RhaS
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[RhaS,+](3)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
 LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  RhaS-L-rhamnose activator rhaBp Sigma70 -73.0 -97.0 rhaB, rhaA, rhaD
catcacgttcATCTTTCCCTGGTTGCCaatggcccat
 4097537 4097553 [APIORCISFBSCS], [BPP], [GEA], [SM] [1], [5], [7], [8], [9], [10], [11]
  RhaS-L-rhamnose activator rhaBp Sigma70 -40.0 -64.0 rhaB, rhaA, rhaD
ccattttcctGTCAGTAACGAGAAGGTcgcgaattca
 4097504 4097520 [APIORCISFBSCS], [BCE], [BPP], [GEA], [SM] [1], [5], [7], [8], [9], [10], [11]
  RhaS-L-rhamnose activator rhaSp Sigma70, Sigma38 -74.0 -99.0 rhaS, rhaR
ttcacgctgtATCTTGAAAAATCGACGttttttacgt
 4097629 4097645 [BPP], [GEA] [1], [12]
  RhaS-L-rhamnose activator rhaSp Sigma70, Sigma38 -40.0 -65.0 rhaS, rhaR
cgtggttttcCGTCGAAAATTTAAGGTaagaacctga
 4097663 4097679 [BPP], [GEA] [1], [12]
  RhaS unknown rhaSp Sigma70, Sigma38 915.0 890.0 rhaS, rhaR
gcgaataatcAACTTCGTTCTCTGGCCGaggtagccac
 4098617 4098634 [APIORCISFBSCS], [BPP] [8]
  RhaS unknown rhaTp Sigma70 -499.0 -540.0 rhaT
cttttttcagACCTTTCCAGAACAGGCtgtggttagc
 4101057 4101073 [APIORCISFBSCS], [BPP] [8]
  RhaS-L-rhamnose activator rhaTp Sigma70 -74.0 -115.0 rhaT
aatcacccacTTAATGCCGTGATTGCCagtaaatcga
 4100632 4100648 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA], [SM] [8], [13]
  RhaS-L-rhamnose activator rhaTp Sigma70 -41.0 -82.0 rhaT
tcgacaacggCGGCAACAGGCGAAAGGttaatcgaca
 4100599 4100615 [AIBSCS], [APIORCISFBSCS], [BPP], [GEA] [8], [13], [14]


Alignment and PSSM for RhaS TFBSs    

Aligned TFBS of RhaS   
  Sequence
  CTGGCAATCACGGCATTAAG
  TTGGCAACCAGGGAAAGATG
  CTTTCCAGAACAGGCTGTGG
  ACGGCGGCAACAGGCGAAAG
  CTGTCAGTAACGAGAAGGTC
  ACCTCGGCCAGAGAACGAAG
  TTTTCCGTCGAAAATTTAAG
  CTTGAAAAATCGACGTTTTT

Position weight matrix (PWM). RhaS matrix-quality result    
A	2	0	0	0	1	4	4	1	4	6	1	4	3	3	4	2	1	5	4	0
C	4	2	1	0	7	2	0	3	4	0	5	0	0	2	2	1	0	0	0	1
G	0	0	4	4	0	2	4	1	0	1	2	4	5	3	1	1	4	1	1	6
T	2	6	3	4	0	0	0	3	0	1	0	0	0	0	1	4	3	2	3	1

Consensus    
;	consensus.strict             	ctggCagccaCgGgatgaaG
;	consensus.strict.rc          	CTTCATCCCGTGGCTGCCAG
;	consensus.IUPAC              	cykkCvrymaSrRvmtkawG
;	consensus.IUPAC.rc           	CWTMAKBYYSTKRYBGMMRG
;	consensus.regexp             	c[ct][gt][gt]C[acg][ag][ct][ac]a[CG][ag][AG][acg][ac]t[gt]a[at]G
;	consensus.regexp.rc          	C[AT]T[AC]A[GT][CGT][CT][CT][CG]T[GT][AG][CT][CGT]G[AC][AC][AG]G

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [GEA] Gene expression analysis

 [SM] Site mutation

 [APPH] Assay of protein purified to homogeneity

 [HIFS] Human inference of function from sequence

 [IEP] Inferred from expression pattern

 [IMP] Inferred from mutant phenotype

 [IPI] Inferred from physical interaction

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [BCE] Binding of cellular extracts

 [AIBSCS] Automated inference based on similarity to consensus sequences


Reference(s)    

 [1] Egan SM., Schleif RF., 1993, A regulatory cascade in the induction of rhaBAD., J Mol Biol 234(1):87-98

 [2] Plunkett G., Burland V., Daniels DL., Blattner FR., 1993, Analysis of the Escherichia coli genome. III. DNA sequence of the region from 87.2 to 89.2 minutes., Nucleic Acids Res 21(15):3391-8

 [3] Tobin JF., Schleif RF., 1987, Positive regulation of the Escherichia coli L-rhamnose operon is mediated by the products of tandemly repeated regulatory genes., J Mol Biol 196(4):789-99

 [4] Kolin A., Balasubramaniam V., Skredenske JM., Wickstrum JR., Egan SM., 2008, Differences in the mechanism of the allosteric l-rhamnose responses of the AraC/XylS family transcription activators RhaS and RhaR., Mol Microbiol 68(2):448-61

 [5] Bhende PM., Egan SM., 1999, Amino acid-DNA contacts by RhaS: an AraC family transcription activator., J Bacteriol 181(17):5185-92

 [6] Bhende PM., Egan SM., 2000, Genetic evidence that transcription activation by RhaS involves specific amino acid contacts with sigma 70., J Bacteriol 182(17):4959-69

 [7] Wickstrum JR., Egan SM., 2004, Amino acid contacts between sigma 70 domain 4 and the transcription activators RhaS and RhaR., J Bacteriol 186(18):6277-85

 [8] Wickstrum JR., Skredenske JM., Kolin A., Jin DJ., Fang J., Egan SM., 2007, Transcription activation by the DNA-binding domain of the AraC family protein RhaS in the absence of its effector-binding domain., J Bacteriol 189(14):4984-93

 [9] Egan SM., Schleif RF., 1994, DNA-dependent renaturation of an insoluble DNA binding protein. Identification of the RhaS binding site at rhaBAD., J Mol Biol 243(5):821-9

 [10] Holcroft CC., Egan SM., 2000, Roles of cyclic AMP receptor protein and the carboxyl-terminal domain of the alpha subunit in transcription activation of the Escherichia coli rhaBAD operon., J Bacteriol 182(12):3529-35

 [11] Holcroft CC., Egan SM., 2000, Interdependence of activation at rhaSR by cyclic AMP receptor protein, the RNA polymerase alpha subunit C-terminal domain, and rhaR., J Bacteriol 182(23):6774-82

 [12] Wickstrum JR., Skredenske JM., Balasubramaniam V., Jones K., Egan SM., 2010, The AraC/XylS family activator RhaS negatively autoregulates rhaSR expression by preventing cyclic AMP receptor protein activation., J Bacteriol 192(1):225-32

 [13] Via P., Badia J., Baldoma L., Obradors N., Aguilar J., 1996, Transcriptional regulation of the Escherichia coli rhaT gene., Microbiology 142 ( Pt 7):1833-40

 [14] Otsuka J., Watanabe H., Mori KT., 1996, Evolution of transcriptional regulation system through promiscuous coupling of regulatory proteins with operons; suggestion from protein sequence similarities in Escherichia coli., J Theor Biol 178(2):183-204

 [15] Wickstrum JR., Santangelo TJ., Egan SM., 2005, Cyclic AMP receptor protein and RhaR synergistically activate transcription from the L-rhamnose-responsive rhaSR promoter in Escherichia coli., J Bacteriol 187(19):6708-18

 [16] Kolin A, Jevtic V, Swint-Kruse L, Egan SM, 2007, Linker regions of the RhaS and RhaR proteins., J Bacteriol, 2007 Jan


RegulonDB