RegulonDB RegulonDB 10.10:Regulon Page
   

CytR DNA-binding transcriptional repressor

Synonyms: CytR-cytidine, CytR
Summary:
CytR, "Cytidine Regulator," is a transcription factor required for transport and utilization of ribonucleosides and deoxyribonucleosides [4, 18, 19, 20, 21, 22, 26] The repressor CytR and the activator CRP, two dimeric proteins, interact to form a complex repressor nucleoprotein in the intergenic region. When only CRP is bound to this promoter, it functions as an activator, and then, when CytR binds to DNA and to CRP, the activation is repressed because CytR masks an activating region of CRP that otherwise would contact the RNA polymerase to activate transcription [29, 30, 30, 31, 32, 33, 34] The CytR protein cannot act alone; the synergistic DNA binding is increased by direct interaction with CRP [13, 15, 35] However, footprinting analyses showed that the dimers of CytR are flanked or "sandwiched" by two dimers of CRP [1, 11, 25, 30] At times CytR also repositions CRP to alternative DNA-binding sites that are not functional for activation [29] Gavigan et al.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
CytR Functional   Apo [BPP] [1]
CytR-cytidine Non-Functional Allosteric Holo [BPP] [1]
Evolutionary Family: GalR/LacI
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: cytR
  Genome position: 4123431-4124456
  Length: 1026 bp / 341 aa
Operon name: cytR
TU(s) encoding the TF:
Transcription unit        Promoter
cytR
cytRp


Regulon       
Regulated gene(s) cdd, cytR, deoA, deoB, deoC, deoD, nupC, nupG, ppiA, rpoH, tsx, udp, ycdZ
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
nucleotide and nucleoside conversions (9)
Transcription related (2)
Porters (Uni-, Sym- and Antiporters) (2)
membrane (2)
activator (1)
Read more >
Regulated operon(s) cdd, cytR, deoCABD, mutY-yggX-mltC-nupG, nupC, ppiA, rpoH, tsx, udp, ycdZ
First gene in the operon(s) cdd, cytR, deoC, nupC, nupG, ppiA, rpoH, tsx, udp, ycdZ
Simple and complex regulons CRP,CytR
CRP,CytR,DeoR
CRP,CytR,DeoR,Fis,ModE
CRP,CytR,DnaA
CRP,CytR,Nac
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[CytR,-](14)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
 LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  CytR repressor cddp Sigma70 -82.5 -107.5 cdd
tgcgatgcgtCGCGCATTTTTGATGTAtgtttcacgc
 2231729 2231745 [GEA], [APIORCISFBSCS], [BPP] [2], [3], [4]
  CytR repressor cddp Sigma70 -64.0 -89.0 cdd
tttgatgtatGTTTCACGCGTTGCATAAttaatgagat
 2231747 2231764 [GEA], [APIORCISFBSCS], [BPP], [SM] [2], [3], [4], [5]
  CytR repressor cytRp Sigma70 -59.0 -112.0 cytR
atcgaaaaatTCAATATTCATCACACTTTTCATGaaaattctgt
 4124557 4124580 [GEA], [IC], [APIORCISFBSCS], [BPP], [IC] [6], [7]
  CytR repressor cytRp Sigma70 -43.0 -96.0 cytR
atcacactttTCATGAAAATTCTGTAACcgttttcacg
 4124544 4124561 [GEA], [IC], [APIORCISFBSCS], [BPP], [IC] [6], [7], [8]
  CytR repressor cytRp Sigma70 -22.0 -75.0 cytR
ttctgtaaccGTTTTCACGCGCTATCTGCTAAaaatgttgcc
 4124521 4124542 [GEA], [IC], [APIORCISFBSCS], [BPP], [IC] [6], [7]
  CytR repressor deoCp2 Sigma70 -87.5 -132.5 deoC, deoA, deoB, deoD
tgaattatttGAACCAGATCGCATTACAGTGAtgcaaacttg
 4617180 4617201 [GEA], [APIORCISFBSCS], [BPP], [SM] [1], [9], [10], [11], [12], [13], [14], [15], [16], [17]
  CytR repressor deoCp2 Sigma70 -70.5 -115.5 deoC, deoA, deoB, deoD
gcattacagtGATGCAAACTTGTAAGTagatttcctt
 4617200 4617216 [GEA], [APIORCISFBSCS], [BPP], [SM] [1], [9], [10], [11], [12], [13], [14], [15], [16], [17]
  CytR repressor deoCp2 Sigma70 -61.0 -106.0 deoC, deoA, deoB, deoD
gtgatgcaaaCTTGTAAGTAGATTTCCTTAattgtgatgt
 4617208 4617227 [GEA], [BPP], [SM] [1], [9], [10], [11], [12], [13], [14], [15], [16], [17]
  CytR repressor nupCp Sigma70 nd nd nupC
nd
 nd nd [TAS], [BPP] [18]
  CytR repressor nupGp Sigma70 -76.5 -139.5 nupG
cacatcacaaTTTCGTTTTGCAAATtgggaatgtt
 3105568 3105582 [APIORCISFBSCS], [BPP] [19]
  CytR repressor nupGp Sigma70 -61.0 -124.0 nupG
cgttttgcaaATTGGGAATGTTTGCAATTatttgccaca
 3105581 3105599 [APIORCISFBSCS], [BPP] [19]
  CytR repressor nupGp Sigma70 -53.0 -116.0 nupG
aaattgggaaTGTTTGCAATTATTTGCCACaggtaacaaa
 3105589 3105608 [APIORCISFBSCS], [BPP] [19]
  CytR repressor ppiAp2 Sigma70 -83.0 -181.0 ppiA
gtgatctgttTAAATGTTTTATTGCAATcggttgctaa
 3492470 3492487 [GEA], [IC], [APIORCISFBSCS], [BPP], [IC] [20]
  CytR repressor ppiAp2 Sigma70 -64.5 -162.5 ppiA
tattgcaatcGGTTGCTAAATTGCATTttaagaggtg
 3492452 3492468 [GEA], [APIORCISFBSCS], [BPP] [20]
  CytR repressor ppiAp3 Sigma70 -48.0 -181.0 ppiA
gtgatctgttTAAATGTTTTATTGCAATcggttgctaa
 3492470 3492487 [BPP], [GEA], [IC], [APIORCISFBSCS], [BPP], [IC] [20]
  CytR repressor ppiAp3 Sigma70 -29.5 -162.5 ppiA
tattgcaatcGGTTGCTAAATTGCATTttaagaggtg
 3492452 3492468 [GEA], [APIORCISFBSCS], [BPP] [20]
  CytR repressor ppiAp4 Sigma70 -29.0 -181.0 ppiA
gtgatctgttTAAATGTTTTATTGCAATcggttgctaa
 3492470 3492487 [GEA], [IC], [APIORCISFBSCS], [BPP], [IC] [20]
  CytR repressor ppiAp4 Sigma70 -10.5 -162.5 ppiA
tattgcaatcGGTTGCTAAATTGCATTttaagaggtg
 3492452 3492468 [GEA], [APIORCISFBSCS], [BPP] [20]
  CytR repressor rpoHp3 Sigma24 -52.0 -139.0 rpoH
tgtcacatttTGTGCGTAATTTATTCACAAgcttgcattg
 3600913 3600932 [GEA], [APIORCISFBSCS], [BPP] [21]
  CytR repressor rpoHp3 Sigma24 -33.5 -120.5 rpoH
ttattcacaaGCTTGCATTGAACTTGTggataaaatc
 3600896 3600912 [GEA], [APIORCISFBSCS], [BPP] [21]
  CytR repressor rpoHp4 Sigma70 -59.0 -139.0 rpoH
tgtcacatttTGTGCGTAATTTATTCACAAgcttgcattg
 3600913 3600932 [GEA], [APIORCISFBSCS], [BPP] [21]
  CytR repressor rpoHp4 Sigma70 -40.5 -120.5 rpoH
ttattcacaaGCTTGCATTGAACTTGTggataaaatc
 3600896 3600912 [GEA], [APIORCISFBSCS], [BPP] [21]
  CytR repressor rpoHp5 Sigma70 -73.5 -139.0 rpoH
tgtcacatttTGTGCGTAATTTATTCACAAgcttgcattg
 3600913 3600932 [GEA], [APIORCISFBSCS], [BPP] [21]
  CytR repressor rpoHp5 Sigma70 -54.5 -120.5 rpoH
ttattcacaaGCTTGCATTGAACTTGTggataaaatc
 3600896 3600912 [GEA], [APIORCISFBSCS], [BPP] [21]
  CytR repressor tsxp2 Sigma70 -68.5 -146.5 tsx
tgtgtaaacgTGAACGCAATCGATTACGTAAatgatagaac
 432150 432170 [GEA], [IC], [APIORCISFBSCS], [BPP], [IC], [SM] [22]
  CytR repressor tsxp2 Sigma70 -57.5 -135.5 tsx
aacgcaatcgATTACGTAAATGATAGAACtgtgaaacga
 432140 432158 [GEA], [IC], [BPP], [IC], [IHBCE] [22], [23]
  CytR repressor tsxp2 Sigma70 -31.5 -109.5 tsx
atagaactgtGAAACGAAACATATTTTTGTGAGCAATgatttttata
 432110 432136 [GEA], [IC], [BPP], [IC], [SM] [22]
  CytR repressor udpP Sigma70 -87.0 -127.0 udp
atttatgtgaTTTGCATCACTTTTGGTGGGtaaatttatg
 4016295 4016314 [GEA], [APIORCISFBSCS], [BPP], [SM] [24], [25], [26]
  CytR repressor udpP Sigma70 -70.5 -110.5 udp
acttttggtgGGTAAATTTATGCAACGcatttgcgtc
 4016313 4016329 [GEA], [APIORCISFBSCS], [BPP], [SM] [24], [25], [26], [27]
  CytR repressor udpP Sigma70 -61.0 -101.0 udp
tgggtaaattTATGCAACGCATTTGCGTCAtggtgatgag
 4016321 4016340 [GEA], [APIORCISFBSCS], [BPP], [SM] [24], [25], [26], [27]
  CytR repressor ycdZp4 Sigma70 -22.0 -66.0 ycdZ
gtcactcataACTGCAACGGATAATTTGTTGTTGCATAAaatgtgtgct
 1100216 1100244 [AIBSCS] [28]


Alignment and PSSM for CytR TFBSs    

Aligned TFBS of CytR   
  Sequence
  CATTGCTCACAAAAATATGTTTC
  AACCGATTGCAATAAAACATTTA
  ACCAGATCGCATTACAGTGATGC
  AATCGGTTGCTAAATTGCATTTT
  CCCAATTTGCAAAACGAAATTGT
  AAACGGTTACAGAATTTTCATGA
  AATTGCAAACATTCCCAATTTGC
  CATTTTATGCAACAACAAATTAT
  ACAAGCTTGCATTGAACTTGTGG
  AATGCGTTGCATAAATTTACCCA
  CATTTTTAGCAGATAGCGCGTGA
  CAGTTCTATCATTTACGTAATCG
  ATCTACTTACAAGTTTGCATCAC
  AAGCTTGTGAATAAATTACGCAC
  CATACATCAAAAATGCGCGACGC
  ACCCACCAAAAGTGATGCAAATC
  TGTTTCACGCGTTGCATAATTAA

Position weight matrix (PWM). CytR matrix-quality result    
A	10	11	2	4	3	3	3	4	6	3	15	7	8	9	9	4	5	5	9	5	1	4	5
C	6	4	5	5	2	7	1	4	0	14	0	0	1	1	4	4	2	5	3	1	4	2	7
G	0	1	2	1	7	3	1	0	10	0	1	3	1	3	1	2	6	1	3	3	0	7	2
T	1	1	8	7	5	4	12	9	1	0	1	7	7	4	3	7	4	6	2	8	12	4	3

Consensus    
;	consensus.strict             	aatcgcttGCAaaaatgcattgc
;	consensus.strict.rc          	GCAATGCATTTTTGCAAGCGATT
;	consensus.IUPAC              	mmyygctyRCAwwamyrhawygm
;	consensus.IUPAC.rc           	KCRWTDYRKTWWTGYRAGCRRKK
;	consensus.regexp             	[ac][ac][ct][ct]gct[ct][AG]CA[at][at]a[ac][ct][ag][act]a[at][ct]g[ac]
;	consensus.regexp.rc          	[GT]C[AG][AT]T[AGT][CT][AG][GT]T[AT][AT]TG[CT][AG]AGC[AG][AG][GT][GT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [SM] Site mutation

 [IC] Inferred by curator

 [TAS] Traceable author statement

 [IHBCE] Inferred by a human based on computational evidence

 [AIBSCS] Automated inference based on similarity to consensus sequences


Reference(s)    

 [1] Pedersen H., Sogaard-Andersen L., Holst B., Valentin-Hansen P., 1991, Heterologous cooperativity in Escherichia coli. The CytR repressor both contacts DNA and the cAMP receptor protein when binding to the deoP2 promoter., J Biol Chem 266(27):17804-8

 [2] Holst B., Sogaard-Andersen L., Pedersen H., Valentin-Hansen P., 1992, The cAMP-CRP/CytR nucleoprotein complex in Escherichia coli: two pairs of closely linked binding sites for the cAMP-CRP activator complex are involved in combinatorial regulation of the cdd promoter., EMBO J 11(10):3635-43

 [3] Holt AK., Senear DF., 2010, An unusual pattern of CytR and CRP binding energetics at Escherichia coli cddP suggests a unique blend of class I and class II mediated activation., Biochemistry 49(3):432-42

 [4] Jorgensen CI., Kallipolitis BH., Valentin-Hansen P., 1998, DNA-binding characteristics of the Escherichia coli CytR regulator: a relaxed spacing requirement between operator half-sites is provided by a flexible, unstructured interdomain linker., Mol Microbiol 27(1):41-50

 [5] Valentin-Hansen P., Holst B., Josephsen J., Hammer K., Albrechtsen B., 1989, CRP/cAMP- and CytR-regulated promoters in Escherichia coli K12: the cdd promoter., Mol Microbiol 3(10):1385-90

 [6] Gerlach P., Valentin-Hansen P., Bremer E., 1990, Transcriptional regulation of the cytR repressor gene of Escherichia coli: autoregulation and positive control by the cAMP/CAP complex., Mol Microbiol 4(3):479-88

 [7] Pedersen H., Sogaard-Andersen L., Holst B., Gerlach P., Bremer E., Valentin-Hansen P., 1992, cAMP-CRP activator complex and the CytR repressor protein bind co-operatively to the cytRP promoter in Escherichia coli and CytR antagonizes the cAMP-CRP-induced DNA bend., J Mol Biol 227(2):396-406

 [8] Pedersen H., Valentin-Hansen P., 1997, Protein-induced fit: the CRP activator protein changes sequence-specific DNA recognition by the CytR repressor, a highly flexible LacI member., EMBO J 16(8):2108-18

 [9] Chahla M., Wooll J., Laue TM., Nguyen N., Senear DF., 2003, Role of protein-protein bridging interactions on cooperative assembly of DNA-bound CRP-CytR-CRP complex and regulation of the Escherichia coli CytR regulon., Biochemistry 42(13):3812-25

 [10] Mollegaard NE., Rasmussen PB., Valentin-Hansen P., Nielsen PE., 1993, Characterization of promoter recognition complexes formed by CRP and CytR for repression and by CRP and RNA polymerase for activation of transcription on the Escherichia coli deoP2 promoter., J Biol Chem 268(23):17471-7

 [11] Perini LT., Doherty EA., Werner E., Senear DF., 1996, Multiple specific CytR binding sites at the Escherichia coli deoP2 promoter mediate both cooperative and competitive interactions between CytR and cAMP receptor protein., J Biol Chem 271(52):33242-55

 [12] Shin M., Kang S., Hyun SJ., Fujita N., Ishihama A., Valentin-Hansen P., Choy HE., 2001, Repression of deoP2 in Escherichia coli by CytR: conversion of a transcription activator into a repressor., EMBO J 20(19):5392-9

 [13] Sogaard-Andersen L., Martinussen J., Mollegaard NE., Douthwaite SR., Valentin-Hansen P., 1990, The CytR repressor antagonizes cyclic AMP-cyclic AMP receptor protein activation of the deoCp2 promoter of Escherichia coli K-12., J Bacteriol 172(10):5706-13

 [14] Sogaard-Andersen L., Mironov AS., Pedersen H., Sukhodelets VV., Valentin-Hansen P., 1991, Single amino acid substitutions in the cAMP receptor protein specifically abolish regulation by the CytR repressor in Escherichia coli., Proc Natl Acad Sci U S A 88(11):4921-5

 [15] Sogaard-Andersen L., Pedersen H., Holst B., Valentin-Hansen P., 1991, A novel function of the cAMP-CRP complex in Escherichia coli: cAMP-CRP functions as an adaptor for the CytR repressor in the deo operon., Mol Microbiol 5(4):969-75

 [16] Sogaard-Andersen L., Valentin-Hansen P., 1991, Restored DNA-binding of the cAMP-CRP activator complex reestablishes negative regulation by the CytR repressor in the deoP2 promoter in Escherichia coli., Mol Gen Genet 231(1):76-80

 [17] Sogaard-Andersen L., Valentin-Hansen P., 1993, Protein-protein interactions in gene regulation: the cAMP-CRP complex sets the specificity of a second DNA-binding protein, the CytR repressor., Cell 75(3):557-66

 [18] Craig JE., Zhang Y., Gallagher MP., 1994, Cloning of the nupC gene of Escherichia coli encoding a nucleoside transport system, and identification of an adjacent insertion element, IS 186., Mol Microbiol 11(6):1159-68

 [19] Pedersen H., Dall J., Dandanell G., Valentin-Hansen P., 1995, Gene-regulatory modules in Escherichia coli: nucleoprotein complexes formed by cAMP-CRP and CytR at the nupG promoter., Mol Microbiol 17(5):843-53

 [20] Norregaard-Madsen M., Mygind B., Pedersen R., Valentin-Hansen P., Sogaard-Andersen L., 1994, The gene encoding the periplasmic cyclophilin homologue, PPIase A, in Escherichia coli, is expressed from four promoters, three of which are activated by the cAMP-CRP complex and negatively regulated by the CytR repressor., Mol Microbiol 14(5):989-97

 [21] Kallipolitis BH., Valentin-Hansen P., 1998, Transcription of rpoH, encoding the Escherichia coli heat-shock regulator sigma32, is negatively controlled by the cAMP-CRP/CytR nucleoprotein complex., Mol Microbiol 29(4):1091-9

 [22] Gerlach P., Sogaard-Andersen L., Pedersen H., Martinussen J., Valentin-Hansen P., Bremer E., 1991, The cyclic AMP (cAMP)-cAMP receptor protein complex functions both as an activator and as a corepressor at the tsx-p2 promoter of Escherichia coli K-12., J Bacteriol 173(17):5419-30

 [23] Bremer E., Gerlach P., Middendorf A., 1988, Double negative and positive control of tsx expression in Escherichia coli., J Bacteriol 170(1):108-16

 [24] Brikun I., Suziedelis K., Stemmann O., Zhong R., Alikhanian L., Linkova E., Mironov A., Berg DE., 1996, Analysis of CRP-CytR interactions at the Escherichia coli udp promoter., J Bacteriol 178(6):1614-22

 [25] Gavigan SA., Nguyen T., Nguyen N., Senear DF., 1999, Role of multiple CytR binding sites on cooperativity, competition, and induction at the Escherichia coli udp promoter., J Biol Chem 274(23):16010-9

 [26] Zolotukhina M., Ovcharova I., Eremina S., Errais Lopes L., Mironov AS., 2003, Comparison of the structure and regulation of the udp gene of Vibrio cholerae, Yersinia pseudotuberculosis, Salmonella typhimurium, and Escherichia coli., Res Microbiol 154(7):510-20

 [27] Zolotukhina MA., Ovcharova IV., Eremina SIu., Errais LL., Mironov AS., 2002, [Functional interrelationship between elements of the Escherichia coli udp gene promotor responsible for binding regulatory proteins CytR, CRP, and RNA polymerase], Genetika 38(9):1223-34

 [28] Sernova NV., Gelfand MS., 2012, Comparative genomics of CytR, an unusual member of the LacI family of transcription factors., PLoS One 7(9):e44194

 [29] Valentin-Hansen P, Søgaard-Andersen L, Pedersen H, 1996, A flexible partnership: the CytR anti-activator and the cAMP-CRP activator protein, comrades in transcription control., Mol Microbiol, 20(3):461 10.1046/j.1365-2958.1996.5341056.x

 [30] Meibom KL, Kallipolitis BH, Ebright RH, Valentin-Hansen P, 2000, Identification of the subunit of cAMP receptor protein (CRP) that functionally interacts with CytR in CRP-CytR-mediated transcriptional repression., J Biol Chem, 275(16):11951 10.1074/jbc.275.16.11951

 [31] Kristensen HH, Valentin-Hansen P, Søgaard-Andersen L, 1997, Design of CytR regulated, cAMP-CRP dependent class II promoters in Escherichia coli: RNA polymerase-promoter interactions modulate the efficiency of CytR repression., J Mol Biol, 266(5):866 10.1006/jmbi.1996.0852

 [32] Meibom KL, Søgaard-Andersen L, Mironov AS, Valentin-Hansen P, 1999, Dissection of a surface-exposed portion of the cAMP-CRP complex that mediates transcription activation and repression., Mol Microbiol, 32(3):497 10.1046/j.1365-2958.1999.01362.x

 [33] Kristensen HH, Valentin-Hansen P, Søgaard-Andersen L, 1996, CytR/cAMP-CRP nucleoprotein formation in E. coli: the CytR repressor binds its operator as a stable dimer in a ternary complex with cAMP-CRP., J Mol Biol, 260(2):113 10.1006/jmbi.1996.0385

 [34] Rasmussen PB, Holst B, Valentin-Hansen P, 1996, Dual-function regulators: the cAMP receptor protein and the CytR regulator can act either to repress or to activate transcription depending on the context., Proc Natl Acad Sci U S A, 93(19):10151 10.1073/pnas.93.19.10151

 [35] Sogaard-Andersen L., Mollegaard NE., Douthwaite SR., Valentin-Hansen P., 1990, Tandem DNA-bound cAMP-CRP complexes are required for transcriptional repression of the deoP2 promoter by the CytR repressor in Escherichia coli., Mol Microbiol 4(9):1595-601

 [36] Kallipolitis BH, Valentin-Hansen P, 2004, A role for the interdomain linker region of the Escherichia coli CytR regulator in repression complex formation., J Mol Biol, 342(1):1 10.1016/j.jmb.2004.05.067

 [37] Weickert MJ, Adhya S, 1992, A family of bacterial regulators homologous to Gal and Lac repressors., J Biol Chem, 267(22):15869 None

 [38] Kallipolitis BH, Nørregaard-Madsen M, Valentin-Hansen P, 1997, Protein-protein communication: structural model of the repression complex formed by CytR and the global regulator CRP., Cell, 89(7):1101 10.1016/s0092-8674(00)80297-4

 [39] Munshi S, Subramanian S, Ramesh S, Golla H, Kalivarathan D, Kulkarni M, Campos LA, Sekhar A, Naganathan AN, 2019, Engineering Order and Cooperativity in a Disordered Protein., Biochemistry, 58(19):2389 10.1021/acs.biochem.9b00182

 [40] Moody CL, Tretyachenko-Ladokhina V, Laue TM, Senear DF, Cocco MJ, 2011, Multiple conformations of the cytidine repressor DNA-binding domain coalesce to one upon recognition of a specific DNA surface., Biochemistry, 50(31):6622 10.1021/bi200205v

 [41] Munshi S, Gopi S, Asampille G, Subramanian S, Campos LA, Atreya HS, Naganathan AN, 2018, Tunable order-disorder continuum in protein-DNA interactions., Nucleic Acids Res, 46(17):8700 10.1093/nar/gky732

 [42] Müller-Hill B, 1998, Some repressors of bacterial transcription., Curr Opin Microbiol, 1(2):145 10.1016/s1369-5274(98)80004-0


RegulonDB