![]() ![]() |
Synonyms: AgaR |
Summary:
"N-acetylgalactosamine repressor," AgaR, negatively controls the expression of the aga gene cluster, which is involved in transport and catabolism of N-acetylgalactosamine and d-galactosamine [1, 2] It is negatively autoregulated and coordinately represses transcription of the divergent agaZVWEFA operon, which is related to transport and degradation of N-acetylgalactosamine [1] This repressor responds to N-acetylgalactosamine and d-galactosamine in the medium. As a member of the DeoR/GlpR family of transcriptional regulators [1] AgaR features an N-terminal domain containing a helix-turn-helix motif and a C-terminal domain that includes the key residues involved in co-inducer recognition and oligomerization [1] In accordance with other helix-turn-helix DNA-binding repressors, AgaR may bind to DNA as a tetramer. AgaR binds in tandem to several repeat sequences in the intergenic regions of agaZp, agaRp, and agaSp to repress transcription by overlapping the -35 and -10 boxes. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||
Evolutionary Family: | DeoR | ||||||||||||
Sensing class: | External sensing using transported metabolites | ||||||||||||
Connectivity class: | Local Regulator | ||||||||||||
Gene name: | agaR | ||||||||||||
Genome position: | 3277856-3278665 | ||||||||||||
Length: | 810 bp / 269 aa | ||||||||||||
Operon name: | agaR | ||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | agaA, agaB, agaC, agaD, agaI, agaR, agaS, agaV, agaW, kbaY, kbaZ | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
Phosphotransferase Systems (PEP-dependent PTS) (5)
carbon compounds (2)
metabolism (1)
amino sugar conversions (1)
Transcription related (1)
Read more >
|
||||||
Regulated operon(s) | agaR, agaS-kbaY-agaBCDI, kbaZ-agaVWA | ||||||
First gene in the operon(s) | agaR, agaS, kbaZ | ||||||
Simple and complex regulons | AgaR AgaR,CRP | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence![]() |
LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
AgaR | repressor | agaRp | Sigma70 | -19.5 | -57.5 | agaR |
tgggcttgcaTTTGCTTAATAGAAAGGCGTtaataggcaa
|
3278713 | 3278732 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaRp | Sigma70 | 8.5 | -30.5 | agaR |
cgttaataggCAAAACGAAATGAAACGAAAgttttacgaa
|
3278686 | 3278705 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaSp | Sigma70 | -274.5 | -361.5 | agaS, kbaY, agaB, agaC, agaD, agaI |
ctggattcagGGTCAATTAGCTTCGTTTTGatagtttgct
|
3281605 | 3281624 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaSp | Sigma70 | -211.5 | -298.5 | agaS, kbaY, agaB, agaC, agaD, agaI |
ccgtaaggccTTTCTTTTTCTTTCGTTTTGatctgtgcag
|
3281668 | 3281687 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaSp | Sigma70 | -94.5 | -181.5 | agaS, kbaY, agaB, agaC, agaD, agaI |
gcatccagcaATCCCTTTTGCTTCCTTTATcttttctttc
|
3281785 | 3281804 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaSp | Sigma70 | -52.5 | -139.5 | agaS, kbaY, agaB, agaC, agaD, agaI |
cgatcacaaaTTTCGTTTTATTTCTTTTTTctccattgaa
|
3281827 | 3281846 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaSp | Sigma70 | -21.5 | -108.5 | agaS, kbaY, agaB, agaC, agaD, agaI |
tccattgaacTTTCAGTTTCTTTTCTATAGattttaatca
|
3281858 | 3281877 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | agaSp | Sigma70 | 22.5 | -65.5 | agaS, kbaY, agaB, agaC, agaD, agaI |
aaagacatcaCCAAGTGAAATGAAACGAAAggcaagtgaa
|
3281901 | 3281920 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | kbaZp | Sigma70 | -75.5 | -123.5 | kbaZ, agaV, agaW, agaA |
tttcagtgacTTTCATTATGTTTCTTTTGTgaatcagatc
|
3278781 | 3278800 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | kbaZp | Sigma70 | -31.5 | -79.5 | kbaZ, agaV, agaW, agaA |
aaccattatcTTTCGTTTTATTTTTATCTCaccatgacgc
|
3278825 | 3278844 | [GEA], [APIORCISFBSCS], [BPP] | [1] | |
AgaR | repressor | kbaZp | Sigma70 | 3.5 | -45.5 | kbaZ, agaV, agaW, agaA |
tgacgcagtaTCAACTGAAACAAAACGAAAgattaatatc
|
3278859 | 3278878 | [GEA], [APIORCISFBSCS], [BPP] | [1] |
Alignment and PSSM for AgaR TFBSs | ![]() |
---|
Aligned TFBS of AgaR |
---|
Sequence | |
---|---|
AACTTTCGTTTCATTTCGTTTTG | |
GCCTTTCTTTTTCTTTCGTTTTG | |
GCCTTTCGTTTCATTTCACTTGG | |
AAATTTCGTTTTATTTCTTTTTT | |
ATCTTTCGTTTTGTTTCAGTTGA | |
GACTTTCATTATGTTTCTTTTGT | |
ATCTTTCGTTTTATTTTTATCTC | |
AACTTTCAGTTTCTTTTCTATAG | |
CCCTTTTGCTTCCTTTATCTTTT | |
CAGGGTCAATTAGCTTCGTTTTG | |
GCCTTTCTATTAAGCAAATGCAA |
Position weight matrix (PWM). AgaR matrix-quality result |
---|
A 5 5 1 0 0 0 0 3 2 0 1 2 5 0 0 1 2 3 1 1 0 2 2 C 2 4 9 0 0 0 10 0 1 0 0 3 3 1 1 0 7 1 2 0 2 0 1 G 4 0 1 1 1 0 0 6 1 0 0 0 3 1 0 0 0 3 1 1 0 3 5 T 0 2 0 10 10 11 1 2 7 11 10 6 0 9 10 10 2 4 7 9 9 6 3 |
Consensus |
---|
; consensus.strict gcCTTTCgtTTtatTTCgttttg ; consensus.strict.rc CAAAACGAAATAAAACGAAAGGC ; consensus.IUPAC rmCTTTCgtTTyvtTTCktttkg ; consensus.IUPAC.rc CMAAAMGAAABRAAACGAAAGKY ; consensus.regexp [ag][ac]CTTTCgtTT[ct][acg]tTTC[gt]ttt[gt]g ; consensus.regexp.rc C[AC]AAA[AC]GAAA[CGT][AG]AAACGAAAG[GT][CT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|