RegulonDB RegulonDB 9.4:Regulon Page
   

AgaR DNA-binding transcriptional repressor

Synonyms: AgaR
Summary:
N-acetylgalactosamine repressor, AgaR, negatively controls the expression of the aga gene cluster, which is involved in transport and catabolism of N-acetylgalactosamine and d-galactosamine [1, 2] It is negatively autoregulated and coordinately represses transcription of the divergent agaZVWEFA operon, which is related to transport and degradation of N-acetylgalactosamine [1] This repressor responds to N-acetylgalactosamine and d-galactosamine in the medium.
As a member of the DeoR/GlpR family of transcriptional regulators [1] AgaR features an N-terminal domain containing a helix-turn-helix motif and a C-terminal domain that includes the key residues involved in co-inducer recognition and oligomerization [1] In accordance with other helix-turn-helix DNA-binding repressors, AgaR may bind to DNA as a tetramer.
AgaR binds in tandem to several repeat sequences in the intergenic regions of agaZp, agaRp, and agaSp to repress transcription by overlapping the -35 and -10 boxes.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
AgaR     nd nd
Evolutionary Family: DeoR
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: agaR
  Genome position: 3277856-3278665
  Length: 810 bp / 269 aa
Operon name: agaR
TU(s) encoding the TF:
Transcription unit        Promoter
agaR
agaRp


Regulon       
Regulated gene(s) agaA, agaB, agaC, agaD, agaI, agaR, agaS, agaV, agaW, kbaY, kbaZ
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Phosphotransferase Systems (PEP-dependent PTS) (6)
carbon compounds (2)
metabolism (1)
amino sugar conversions (1)
Transcription related (1)
Read more >
Regulated operon(s) agaR, agaS-kbaY-agaBCDI, kbaZ-agaVWA
First gene in the operon(s) agaR, agaS, kbaZ
Simple and complex regulons AgaR
AgaR,CRP
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[AgaR,-](3)


Transcription factor binding sites (TFBSs) arrangements       

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
 LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  AgaR repressor agaRp Sigma70 -19.5 -57.5 agaR
tgggcttgcaTTTGCTTAATAGAAAGGCGTtaataggcaa
 3278713 3278732 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaRp Sigma70 8.5 -30.5 agaR
cgttaataggCAAAACGAAATGAAACGAAAgttttacgaa
 3278686 3278705 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaSp Sigma70 -274.5 -361.5 agaS, kbaY, agaB, agaC, agaD, agaI
ctggattcagGGTCAATTAGCTTCGTTTTGatagtttgct
 3281605 3281624 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaSp Sigma70 -211.5 -298.5 agaS, kbaY, agaB, agaC, agaD, agaI
ccgtaaggccTTTCTTTTTCTTTCGTTTTGatctgtgcag
 3281668 3281687 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaSp Sigma70 -94.5 -181.5 agaS, kbaY, agaB, agaC, agaD, agaI
gcatccagcaATCCCTTTTGCTTCCTTTATcttttctttc
 3281785 3281804 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaSp Sigma70 -52.5 -139.5 agaS, kbaY, agaB, agaC, agaD, agaI
cgatcacaaaTTTCGTTTTATTTCTTTTTTctccattgaa
 3281827 3281846 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaSp Sigma70 -21.5 -108.5 agaS, kbaY, agaB, agaC, agaD, agaI
tccattgaacTTTCAGTTTCTTTTCTATAGattttaatca
 3281858 3281877 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor agaSp Sigma70 22.5 -65.5 agaS, kbaY, agaB, agaC, agaD, agaI
aaagacatcaCCAAGTGAAATGAAACGAAAggcaagtgaa
 3281901 3281920 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor kbaZp Sigma70 -75.5 -123.5 kbaZ, agaV, agaW, agaA
tttcagtgacTTTCATTATGTTTCTTTTGTgaatcagatc
 3278781 3278800 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor kbaZp Sigma70 -31.5 -79.5 kbaZ, agaV, agaW, agaA
aaccattatcTTTCGTTTTATTTTTATCTCaccatgacgc
 3278825 3278844 [BPP], [GEA], [HIBSCS] [1]
  AgaR repressor kbaZp Sigma70 3.5 -45.5 kbaZ, agaV, agaW, agaA
tgacgcagtaTCAACTGAAACAAAACGAAAgattaatatc
 3278859 3278878 [BPP], [GEA], [HIBSCS] [1]


Alignment and PSSM for AgaR TFBSs    

Aligned TFBS of AgaR   
  Sequence
  CTTTCGTTTCATTTCGTTTT
  TATTAACGCCTTTCTATTAA
  CTTTCATTATGTTTCTTTTG
  CTTTCGTTTTATTTTTATCT
  CTTTCGTTTTGTTTCAGTTG
  AATTAGCTTCGTTTTGATAG
  CTTTCTTTTTCTTTCGTTTT
  CTTTTGCTTCCTTTATCTTT
  ATTTCGTTTTATTTCTTTTT
  TTTCAGTTTCTTTTCTATAG
  CTTTCGTTTCATTTCACTTG

Position weight matrix (PWM).    
A	2	2	0	0	3	2	0	0	1	0	4	0	0	0	1	3	3	0	3	1
C	7	0	0	1	7	0	3	0	1	6	2	0	0	1	7	0	2	0	1	0
G	0	0	0	0	0	8	0	1	0	0	3	0	0	0	0	3	1	0	0	5
T	2	9	11	10	1	1	8	10	9	5	2	11	11	10	3	5	5	11	7	5

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [HIBSCS] Human inference based on similarity to consensus sequences


Reference(s)    

 [1] Ray WK., Larson TJ., 2004, Application of AgaR repressor and dominant repressor variants for verification of a gene cluster involved in N-acetylgalactosamine metabolism in Escherichia coli K-12., Mol Microbiol. 51(3):813-26

 [2] Brinkkotter A., Kloss H., Alpert C., Lengeler JW., 2000, Pathways for the utilization of N-acetyl-galactosamine and galactosamine in Escherichia coli., Mol Microbiol. 37(1):125-35

 [3] Reizer J., Ramseier TM., Reizer A., Charbit A., Saier MH., 1996, Novel phosphotransferase genes revealed by bacterial genome sequencing: a gene cluster encoding a putative N-acetylgalactosamine metabolic pathway in Escherichia coli., Microbiology. 142 ( Pt 2):231-50


RegulonDB