RegulonDB RegulonDB 10.8:Regulon Page

GlpR DNA-binding transcriptional repressor

Synonyms: GlpR, GlpR-sn-glycerol 3-phosphate, GlpR-glycerol
The sn-Glycerol-3-phosphate repressor," GlpR, acts as the repressor of the glycerol-3-phosphate regulon, which is organized in different operons [1, 2, 4, 6, 8, 9, 10]. This regulator is part of the glpEGR operon, yet it can also be constitutively expressed as an independent (glpR) transcription unit [11]. In addition, the operons regulated are induced when Escherichia coli is grown in the presence of inductor, glycerol, or glycerol-3-phosphate (G3P), and the absence of glucose [4] In the absence of inductor, this repressor binds in tandem to inverted repeat sequences that consist of 20-nucleotide-long DNA target sites [1, 4, 5]. Binding of GlpR to DNA is diminished in the presence of the inducers glycerol or G3P. An electrophoretic mobility shift assay (EMSA) showed ribose-5-P enhanced GlpR binding to DNA, counteracting the glycerol-3-P dissociation effect [12]. GlpR belongs to the DeoR family of transcriptional regulators [3].
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GlpR Functional   Apo [BPP], [IE], [IPI] [1], [2], [3]
GlpR-sn-glycerol 3-phosphate Non-Functional Allosteric Holo [BPP], [IPI] [2]
GlpR-glycerol Non-Functional   Holo nd [4]
Evolutionary Family: DeoR
Sensing class: Sensing external and internal signals
Connectivity class: Local Regulator
Gene name: glpR
  Genome position: 3559848-3560605
  Length: 758 bp / 251 aa
Operon name: glpEGR
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) glpA, glpB, glpC, glpD, glpF, glpK, glpQ, glpT, glpX
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
misc. glycerol metabolism (8)
membrane (5)
anaerobic respiration (4)
electron donors (4)
aerobic respiration (2)
Read more >
Regulated operon(s) glpABC, glpD, glpFKX, glpTQ
First gene in the operon(s) glpA, glpD, glpF, glpT
Simple and complex regulons ArcA,CRP,FNR,Fis,FlhDC,GlpR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  GlpR repressor glpABCp Sigma70 -90.5 -154.5 glpA, glpB, glpC
2352483 2352502 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5]
  GlpR repressor glpABCp Sigma70 -50.5 -114.5 glpA, glpB, glpC
2352523 2352542 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5]
  GlpR repressor glpABCp Sigma70 -18.5 -82.5 glpA, glpB, glpC
2352555 2352574 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5]
  GlpR repressor glpABCp Sigma70 1.5 -63.5 glpA, glpB, glpC
2352574 2352593 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5]
  GlpR repressor glpABCp Sigma70 41.5 -23.5 glpA, glpB, glpC
2352614 2352633 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5]
  GlpR repressor glpDp Sigma70 -0.5 -42.5 glpD
3561961 3561980 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [5], [6], [7]
  GlpR repressor glpDp Sigma70 19.5 -23.5 glpD
3561980 3561999 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [5], [6], [7]
  GlpR repressor glpDp Sigma70 414.5 372.5 glpD
3562375 3562394 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [6]
  GlpR repressor glpDp Sigma70 455.5 413.5 glpD
3562416 3562435 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [6]
  GlpR repressor glpFp Sigma70 -79.5 -150.5 glpF, glpK, glpX
4118231 4118250 [APIORCISFBSCS], [BPP] [8]
  GlpR repressor glpFp Sigma70 -58.5 -129.5 glpF, glpK, glpX
4118210 4118229 [APIORCISFBSCS], [BPP] [8]
  GlpR repressor glpFp Sigma70 -37.5 -108.5 glpF, glpK, glpX
4118189 4118208 [APIORCISFBSCS], [BPP] [8]
  GlpR repressor glpFp Sigma70 -17.5 -88.5 glpF, glpK, glpX
4118169 4118188 [APIORCISFBSCS], [BPP] [8]
  GlpR repressor glpFp Sigma70 1001.5 930.5 glpF, glpK, glpX
4117151 4117170 [APIORCISFBSCS], [BPP] [8]
  GlpR repressor glpFp Sigma70 1043.5 972.5 glpF, glpK, glpX
4117109 4117128 [APIORCISFBSCS], [BPP] [8]
  GlpR repressor glpTQp Sigma70 -172.5 -249.5 glpT, glpQ
2352614 2352633 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5], [9]
  GlpR repressor glpTQp Sigma70 -132.5 -209.5 glpT, glpQ
2352574 2352593 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5], [9]
  GlpR repressor glpTQp Sigma70 -113.5 -190.5 glpT, glpQ
2352555 2352574 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5], [9]
  GlpR repressor glpTQp Sigma70 -81.5 -158.5 glpT, glpQ
2352523 2352542 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5], [9]
  GlpR repressor glpTQp Sigma70 -41.5 -118.5 glpT, glpQ
2352483 2352502 [APIORCISFBSCS], [BPP], [CV(SM)], [SM] [1], [5]
  GlpR repressor glpTQp Sigma70 315.5 238.5 glpT, glpQ
2352127 2352146 [BPP], [CV(SM)], [GEA], [SM] [9]
  GlpR repressor glpTQp Sigma70 333.5 256.5 glpT, glpQ
2352109 2352128 [BPP], [CV(SM)], [GEA], [SM] [9]
  GlpR repressor glpTQp Sigma70 348.5 271.5 glpT, glpQ
2352094 2352113 [BPP], [CV(SM)], [GEA], [SM] [9]

Alignment and PSSM for GlpR TFBSs    

Aligned TFBS of GlpR   

Position weight matrix (PWM). GlpR matrix-quality result   
A	10	11	5	10	1	0	5	0	2	7	10	8	11	9	0	3	10	11	5	11	2	1
C	1	1	2	0	3	0	8	1	13	2	0	1	1	0	14	1	6	1	11	0	2	4
G	1	0	0	2	1	17	1	8	2	7	4	1	0	0	1	12	1	3	0	3	3	3
T	5	5	10	5	12	0	3	8	0	1	3	7	5	8	2	1	0	2	1	3	10	9

;	consensus.strict             	aatatGcgCgaaaaCGaaCatt
;	consensus.strict.rc          	AATGTTCGTTTTCGCGCATATT
;	consensus.IUPAC              	aawatGmkCrrwawCGmaMaty
;	consensus.IUPAC.rc           	RATKTKCGWTWYYGMKCATWTT
;	consensus.regexp             	aa[at]atG[ac][gt]C[ag][ag][at]a[at]CG[ac]a[AC]at[ct]
;	consensus.regexp.rc          	[AG]AT[GT]T[GT]CG[AT]T[AT][CT][CT]G[AC][GT]CAT[AT]TT

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [BPP] Binding of purified proteins

 [IE] Inferred from experiment

 [IPI] Inferred from physical interaction

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [CV(SM)] cross validation(SM)

 [SM] Site mutation

 [CV(GEA)] cross validation(GEA)

 [GEA] Gene expression analysis

 [CV(GEA/SM)] cross validation(GEA/SM)


 [1] Larson TJ., Cantwell JS., van Loo-Bhattacharya AT., 1992, Interaction at a distance between multiple operators controls the adjacent, divergently transcribed glpTQ-glpACB operons of Escherichia coli K-12., J Biol Chem 267(9):6114-21

 [2] Larson TJ., Ye SZ., Weissenborn DL., Hoffmann HJ., Schweizer H., 1987, Purification and characterization of the repressor for the sn-glycerol 3-phosphate regulon of Escherichia coli K12., J Biol Chem 262(33):15869-74

 [3] Zeng G., Ye S., Larson TJ., 1996, Repressor for the sn-glycerol 3-phosphate regulon of Escherichia coli K-12: primary structure and identification of the DNA-binding domain., J Bacteriol 178(24):7080-9

 [4] Lin EC., 1976, Glycerol dissimilation and its regulation in bacteria., Annu Rev Microbiol 30:535-78

 [5] Zhao N., Oh W., Trybul D., Thrasher KS., Kingsbury TJ., Larson TJ., 1994, Characterization of the interaction of the glp repressor of Escherichia coli K-12 with single and tandem glp operator variants., J Bacteriol 176(8):2393-7

 [6] Yang B., Larson TJ., 1996, Action at a distance for negative control of transcription of the glpD gene encoding sn-glycerol 3-phosphate dehydrogenase of Escherichia coli K-12., J Bacteriol 178(24):7090-8

 [7] Ye SZ., Larson TJ., 1988, Structures of the promoter and operator of the glpD gene encoding aerobic sn-glycerol-3-phosphate dehydrogenase of Escherichia coli K-12., J Bacteriol 170(9):4209-15

 [8] Weissenborn DL., Wittekindt N., Larson TJ., 1992, Structure and regulation of the glpFK operon encoding glycerol diffusion facilitator and glycerol kinase of Escherichia coli K-12., J Biol Chem 267(9):6122-31

 [9] Yang B., Gerhardt SG., Larson TJ., 1997, Action at a distance for glp repressor control of glpTQ transcription in Escherichia coli K-12., Mol Microbiol 24(3):511-21

 [10] Truniger V., Boos W., Sweet G., 1992, Molecular analysis of the glpFKX regions of Escherichia coli and Shigella flexneri., J Bacteriol 174(21):6981-91

 [11] Yang B., Larson TJ., 1998, Multiple promoters are responsible for transcription of the glpEGR operon of Escherichia coli K-12., Biochim Biophys Acta 1396(1):114-26

 [12] Vimala A., Harinarayanan R., 2016, Transketolase activity modulates glycerol-3-phosphate levels in Escherichia coli., Mol Microbiol 100(2):263-77

 [13] Freddolino PL, Amini S, Tavazoie S, 2012, Newly identified genetic variations in common Escherichia coli MG1655 stock cultures., J Bacteriol, 2012 Jan
