RegulonDB RegulonDB 9.3:Regulon Page
   

LexA DNA-binding transcriptional repressor

Synonyms: LexA
Summary:
LexA represses the transcription of several genes involved in the cellular response to DNA damage or inhibition of DNA replication |CITS:[2994755][10760155 ]| as well as its own synthesis |CITS:[ 6990417]|. This regulation is known as the SOS response |CITS:[2994755]|.
When DNA is damaged, the RecA coprotease binds to the single-stranded DNA in the damaged region to form a filament |CITS:[ 18497818 ][ 17364684]|. This filament interacts with the LexA dimer to activate its self-cleavage activity by an allosteric mechanism, causing the dissociation of LexA from its DNA targets and the induction of the SOS regulon for the repair of broken DNA |CITS:[ 18234215][1911941]|. The conformational flexibility of unbound LexA is the key element in establishing a coordinated SOS response |CITS:[21576225]|.
LexA is widely distributed in bacteria, and it appears that it emerged from the gram-positive group |CITS:[15528664]|. It shows two domains, the N-terminal domain involved in DNA binding via a helix-turn-helix |CITS:[ 8076591]| and the C-terminal domain involved in dimerization and in cleavage activity |CITS:[11551506][2968919]|.
To repress transcription, LexA blocks the access of RNA polymerase to target promoters |CITS:[ 7027255 ]|.
LexA dimer |CITS:[10671501]| recognizes and binds to an imperfect inverted repeat DNA sequence called the LexA box or SOS box |CITS:[ 14630651][ 6371470 ]|. Although, the majority of the LexA-regulated genes have only one SOS box, some have two or three boxes which sometimes overlap |CITS:[ 18524933]|.
The crystal structure of the LexA-DNA complex has been determined |CITS:[20703307]|.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
LexA     nd nd
Evolutionary Family: LexA
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: lexA
  Genome position: 4257115-4257723
  Length: 609 bp / 202 aa
Operon name: lexA-dinF
TU(s) encoding the TF:
Transcription unit        Promoter
lexA-dinF
lexAp


Regulon       
Regulated gene(s) cho, ddlB, dinB, dinD, dinF, dinG, dinI, dinJ, dinQ, dnaG, ftsA, ftsI, ftsK, ftsL, ftsQ, ftsW, ftsZ, hokE, insK, lexA, lpxC, molR_1, mraY, murC, murD, murE, murF, murG, phr, polB, ptrA, recA, recB, recD, recN, recX, rpoD, rpsU, ruvA, ruvB, sbmC, ssb, sulA, symE, tisB, umuC, umuD, uvrA, uvrB, uvrC, uvrD, uvrY, yafN, yafO, yafP, yafQ, ybfE, ydjM, yebG
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
SOS response (26)
DNA repair (23)
cell division (9)
murein (peptidoglycan) (8)
murein (8)
Read more >
Regulated operon(s) cho, dinB-yafNOP, dinD, dinG, dinI, dinJ-yafQ, dinQ, ftsK, hokE, insK, lexA-dinF, molR_1, mraZ-rsmH-ftsLI-murEF-mraY-murD-ftsW-murGC-ddlB-ftsQAZ-lpxC, polB, ptrA-recBD, recAX, recN, rpsU-dnaG-rpoD, ruvAB, sbmC, ssb, sulA, symE, tisB, umuDC, uvrA, uvrB, uvrD, uvrYC, ybfE, ybgA-phr, ydjM, yebG
First gene in the operon(s) cho, dinB, dinD, dinG, dinI, dinJ, dinQ, ftsK, ftsL, hokE, insK, lexA, molR_1, phr, polB, ptrA, ptrA, recA, recA, recN, rpsU, ruvA, ruvA, sbmC, ssb, sulA, symE, tisB, umuD, uvrA, uvrB, uvrC, uvrD, uvrY, yafN, ybfE, ydjM, yebG
Simple and complex regulons ArcA,LexA
CRP,LexA
DinJ-YafQ,LexA
LexA
LexA,NagC
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[LexA,-](34)


Transcription factor binding sites (TFBSs) arrangements       

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  LexA repressor chop Sigma70 -0.5 -23.5 cho
ccgcctgttaCACTGGATAGATAACCAGCAttcggagtca
1823482 1823501 [AIBSCS], [HIBSCS] [1], [2], [3], [4]
  LexA repressor dinBp Sigma70 -6.5 -24.5 dinB, yafN, yafO, yafP
accctgaaatCACTGTATACTTTACCAGTGttgagaggtg
250864 250883 [AIBSCS], [HIBSCS], [ICWHO] [1], [2], [3], [4], [5]
  LexA repressor dinDp nd 8.5 -53.5 dinD
agatactcacAACTGTATATAAATACAGTTacagatttac
3817697 3817716 [AIBSCS], [GEA], [HIBSCS] [1], [3], [4], [6], [7]
  LexA repressor dinGp Sigma70 -27.5 -24.5 dinG
aatgccacaaTATTGGCTGTTTATACAGTAtttcaggttt
833036 833055 [AIBSCS], [BPP], [GEA] [8], [9]
  LexA repressor dinIp Sigma70 -7.5 -29.5 dinI
aggttattttACCTGTATAAATAACCAGTAtattcaacag
1121507 1121526 [AIBSCS], [BPP], [GEA], [HIBSCS], [IHBCE], [SM] [1], [3], [4], [6], [10]
  LexA repressor dinJp Sigma70 89.5 -24.5 dinJ, yafQ
ctacaattcaAGCTGAATAAATATACAGCAcaggagatac
246517 246536 [AIBSCS], [GEA] [6], [11]
  LexA repressor dinQp Sigma70 -29.5 -223.5 dinQ
tgcaaggacgTGCTGGTTTTATAACCTGCAtgtactgtat
3648002 3648021 [HIBSCS] [12]
  LexA repressor dinQp Sigma70 -7.5 -201.5 dinQ
aacctgcatgTACTGTATGATTATCCAGTTagctctgagg
3647980 3647999 [AIBSCS], [GEA], [HIBSCS] [1], [12]
  LexA repressor ftsKp1 Sigma70 -0.5 -86.5 ftsK
ttgattacacTCCTGTTAATCCATACAGCAacagtactgg
933128 933147 [AIBSCS], [BPP], [GEA] [6], [8], [13]
  LexA repressor ftsLp2 nd 3.0 -18.5 ftsL, ftsI, murE, murF, mraY, murD, ftsW, murG, murC, ddlB, ftsQ, ftsA, ftsZ, lpxC
cgtagttcagTTCTGCGTATTGCAGAGAGGacgaatgcat
91004 91023 [HIBSCS] [14], [15]
  LexA repressor hokEp Sigma24 -81.5 -186.5 hokE
aaacaggactCACTGTATAAATAAACAGCTattttgttga
607640 607659 [AIBSCS] [2]
  LexA repressor insKp Sigma24 nd nd insK nd nd [AIBSCS], [GEA] [1]
  LexA repressor lexAp Sigma70 -50.5 -78.5 lexA, dinF
ttcgataaatCTCTGGTTTATTGTGCAGTTtatggttcca
4257027 4257046 [HIBSCS] [6], [16]
  LexA repressor lexAp Sigma70 -9.0 -37.5 lexA, dinF
aatcgcctttTGCTGTATATACTCACAGCAtaactgtata
4257068 4257087 [BPP], [HIBSCS] [16], [17]
  LexA repressor lexAp Sigma70 13.0 -16.5 lexA, dinF
ctcacagcatAACTGTATATACACCCAGGGggcggaatga
4257089 4257108 [BPP], [HIBSCS] [16], [17]
  LexA repressor molR_1p Sigma70 11.5 -18.5 molR_1
catctgcattCAACTGGATAAAATTACAGGgatgcagaat
2196446 2196465 [AIBSCS] [1]
  LexA repressor phrBp nd -66.5 -152.5 phr
gccagcagctGGCTGCGCTTATCGACAGTTatcgccgtgg
739345 739364 [HIBSCS] [6], [18]
  LexA repressor phrBp nd 25.5 -61.5 phr
ttatcctgacGCCTGGCTTTCAGGGCAGCGttatttcgaa
739436 739455 [GEA], [HIBSCS] [19]
  LexA repressor polBp Sigma70 -40.5 -63.5 polB
gggcagtaatGACTGTATAAAACCACAGCCaatcaaacga
65834 65853 [AIBSCS], [BPP], [GEA] [6], [8]
  LexA repressor ptrAp Sigma70 20.5 -107.5 ptrA, recB, recD
ccagtcacggACTGATGGTTATATAAACATaggctgactc
2958982 2959001 [BPP], [SM] [4]
  LexA repressor recAp Sigma70 -20.0 -69.5 recA, recX
aaacacttgaTACTGTATGAGCATACAGTAtaattgcttc
2823829 2823848 [BPP] [16], [17]
  LexA repressor recNp Sigma70 -22.5 -58.5 recN
ccagcctcttTACTGTATATAAAACCAGTTtatactgtac
2751727 2751746 [AIBSCS], [BPP] [20]
  LexA repressor recNp Sigma70 -0.5 -36.5 recN
aaccagtttaTACTGTACACAATAACAGTAatggtttttc
2751749 2751768 [AIBSCS], [BPP] [20]
  LexA repressor rpsUp3 Sigma70 4.5 -42.5 rpsU, dnaG, rpoD
attttgaaatAAGCTGGCGTTGATGCCAGCggcaaaccga
3210729 3210748 [BCE], [SM] [21], [22]
  LexA repressor ruvAp1 nd -63.5 -111.5 ruvA, ruvB
aataaattatACTGTGCCATTTTTCAGTTCatcgagacac
1946078 1946097 [HIBSCS] [6], [23]
  LexA repressor ruvAp1 nd -12.5 -60.5 ruvA, ruvB
tcttcatcctTCGCTGGATATCTATCCAGCatttttttat
1946027 1946046 [BPP], [HIBSCS] [1], [6], [23], [24]
  LexA repressor ruvAp2 nd -72.5 -112.5 ruvA, ruvB
gaataaattaTACTGTGCCATTTTTCAGTTcatcgagaca
1946079 1946098 [HIBSCS] [6], [23]
  LexA repressor ruvAp2 nd -19.5 -59.5 ruvA, ruvB
cttcatccttCGCTGGATATCTATCCAGCAtttttttatc
1946026 1946045 [BPP], [HIBSCS] [1], [6], [23], [24]
  LexA repressor sbmCp2 nd 17.5 -24.5 sbmC
tttgcaactaTACTGTATATAAAAACAGTAtcaatggagg
2081277 2081296 [GEA], [IHBCE] [25]
  LexA repressor ssbp3 Sigma70 -46.5 -160.5 ssb
acacaaattgACCTGAATGAATATACAGTAttggaatgca
4273955 4273974 [BCE], [HIBSCS] [26], [27]
  LexA repressor sulAp Sigma70 -2.0 -29.5 sulA
ctggatgtacTGTACATCCATACAGTAACTcacaggggct
1020939 1020958 [BCE] [28]
  LexA repressor symEp Sigma70 -8.5 -85.5 symE
tccccatattTACTGATGATATATACAGGTatttagcgcg
4579916 4579935 [AIBSCS], [BPP] [1], [6]
  LexA repressor tisBp nd -28.0 -244.5 tisB
gtccaaatatTACTGTTTATTTATACAGTAaacttctata
3853299 3853318 [GEA], [ICA] [1], [29]
  LexA repressor umuDp Sigma70 -20.5 -49.5 umuD, umuC
atcagtattgATCTGCTGGCAAGAACAGACtactgtatat
1230708 1230727 [HIBSCS] [6], [30], [31]
  LexA repressor umuDp Sigma70 -0.5 -29.5 umuD, umuC
aagaacagacTACTGTATATAAAAACAGTAtaacttcagg
1230728 1230747 [BPP] [6], [30]
  LexA repressor uvrAp Sigma70 -28.5 -93.5 uvrA
tgcattccaaTACTGTATATTCATTCAGGTcaatttgtgt
4273955 4273974 [BCE], [HIBSCS] [26], [27]
  LexA repressor uvrBp2 Sigma70 -20.0 -84.5 uvrB
tatggtgatgAACTGTTTTTTTATCCAGTAtaatttgttg
813432 813451 [BPP], [HIBSCS] [32]
  LexA repressor uvrCp3 Sigma70 nd nd uvrC nd nd [GEA] [33]
  LexA repressor uvrDp1 Sigma70 11.0 -66.5 uvrD
taatcagcaaATCTGTATATATACCCAGCTttttggcgga
3997907 3997926 [HIBSCS] [34]
  LexA repressor uvrYp2 Sigma70 -129.5 -176.5 uvrY, uvrC
tcgtagggctTACTGTGAAACGATCCGGTAagccgttggt
1995526 1995545 [AIBSCS], [GEA] [33]
  LexA repressor yafNp Sigma70 -1.5 -37.5 yafN, yafO, yafP
ttatgatgtaTACTATTATGTATATTCTGGtgtgcattat
251958 251977 [HIBSCS] [35]
  LexA repressor ybfEp Sigma32 -85.5 -126.5 ybfE
tgattaacgcAACTGATTAAAAACCCAGCGtccgcgtcgc
712015 712034 [AIBSCS] [2]
  LexA repressor ydjMp Sigma70 -1.5 -42.5 ydjM
cacttccgtgCACTGTATAAAAATCCTATActgtacgtat
1810159 1810178 [AIBSCS], [BPP], [GEA] [1]
  LexA repressor ydjMp Sigma70 17.5 -24.5 ydjM
aaaaatcctaTACTGTACGTATCGACAGTTtagtgagttt
1810177 1810196 [AIBSCS], [BPP], [GEA] [1]
  LexA repressor yebGp Sigma70 -9.5 -27.5 yebG
aaaagaaataTACTGTATAAAATCACAGTTattatgagag
1930765 1930784 [AIBSCS], [GEA], [HIBSCS], [IHBCE] [1], [3], [4], [36]


Alignment and PSSM for LexA TFBSs    

Aligned TFBS of LexA   
  Sequence
  GACTGTATAAAACCACAGCC
  TCCTCTCTGCAATACGCAGA
  AGCTGAATAAATATACAGCA
  CACTGTATACTTTACCAGTG
  ACCAGAATATACATAATAGT
  CACTGTATAAATAAACAGCT
  AACTGATTAAAAACCCAGCG
  AACTGTCGATAAGCGCAGCC
  CGCTGCCCTGAAAGCCAGGC
  TACTGGATAAAAAAACAGTT
  TACTGTATAAACAGCCAATA
  TGCTGTATGGATTAACAGGA
  TACTGTATGGATGTACAGTA
  ACCTGTATAAATAACCAGTA
  ATCTGCTGGCAAGAACAGAC
  TACTGTATATAAAAACAGTA
  CACTGTATAAAAATCCTATA
  AACTGTCGATACGTACAGTA
  CACTGGATAGATAACCAGCA
  TACTGTATAAAATCACAGTT
  TGCTGGATAGATATCCAGCG
  AACTGAAAAATGGCACAGTA
  TACCGGATCGTTTCACAGTA
  TACTGTATATAAAAACAGTA
  AACTGGATAAAATTACAGGG
  TACTGTATATAAAACCAGTT
  TACTGTACACAATAACAGTA
  TACTGTATGAGCATACAGTA
  CTATGTTTATATAACCATCA
  AGCTGGCGTTGATGCCAGCG
  AACTGGATAATCATACAGTA
  TGCAGGTTATAAAACCAGCA
  AACTGTATATAAATACAGTT
  TACTGTATAAATAAACAGTA
  ATCTGTATATATACCCAGCT
  AACTGCACAATAAACCAGAG
  TGCTGTATATACTCACAGCA
  AACTGTATATACACCCAGGG
  ACCTGAATGAATATACAGTA
  TACTGATGATATATACAGGT

Position weight matrix (PWM).   
A	16	26	1	2	0	6	30	1	31	16	33	18	25	16	23	1	37	4	2	21
C	6	4	39	1	1	3	5	3	1	4	0	7	1	9	16	38	1	0	12	4
G	1	7	0	0	39	8	0	5	6	6	2	1	5	3	1	1	0	35	7	7
T	17	3	0	37	0	23	5	31	2	14	5	14	9	12	0	0	2	1	19	8

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [HIBSCS] Human inference based on similarity to consensus sequences

 [ICWHO] Inferred computationally without human oversight

 [GEA] Gene expression analysis

 [BPP] Binding of purified proteins

 [IHBCE] Inferred by a human based on computational evidence

 [SM] Site mutation

 [BCE] Binding of cellular extracts

 [ICA] Inferred by computational analysis



Reference(s)    

 [1] Fernandez De Henestrosa AR., Ogi T., Aoyagi S., Chafin D., Hayes JJ., Ohmori H., Woodgate R., 2000, Identification of additional genes belonging to the LexA regulon in Escherichia coli., Mol Microbiol. 35(6):1560-72

 [2] Gillor O., Vriezen JA., Riley MA., 2008, The role of SOS boxes in enteric bacteriocin regulation., Microbiology. 154(Pt 6):1783-92

 [3] Kaleta C., Gohler A., Schuster S., Jahreis K., Guthke R., Nikolajewa S., 2010, Integrative inference of gene-regulatory networks in Escherichia coli using information theoretic concepts and sequence analysis., BMC Syst Biol. 4:116

 [4] Wade JT., Reppas NB., Church GM., Struhl K., 2005, Genomic analysis of LexA binding reveals the permissive nature of the Escherichia coli genome and identifies unconventional target sites., Genes Dev. 19(21):2619-30

 [5] Ohmori H., Hatada E., Qiao Y., Tsuji M., Fukuda R., 1995, dinP, a new gene in Escherichia coli, whose product shows similarities to UmuC and its homologues., Mutat Res. 347(1):1-7

 [6] Lewis LK., Harlow GR., Gregg-Jolly LA., Mount DW., 1994, Identification of high affinity binding sites for LexA which define new DNA damage-inducible genes in Escherichia coli., J Mol Biol. 241(4):507-23

 [7] Ohmori H., Saito M., Yasuda T., Nagata T., Fujii T., Wachi M., Nagai K., 1995, The pcsA gene is identical to dinD in Escherichia coli., J Bacteriol. 177(1):156-65

 [8] Lewis LK., Jenkins ME., Mount DW., 1992, Isolation of DNA damage-inducible promoters in Escherichia coli: regulation of polB (dinA), dinG, and dinH by LexA repressor., J Bacteriol. 174(10):3377-85

 [9] Lewis LK., Mount DW., 1992, Interaction of LexA repressor with the asymmetric dinG operator and complete nucleotide sequence of the gene., J Bacteriol. 174(15):5110-6

 [10] Yasuda T., Nagata T., Ohmori H., 1996, Multicopy suppressors of the cold-sensitive phenotype of the pcsA68 (dinD68) mutation in Escherichia coli., J Bacteriol. 178(13):3854-9

 [11] Ruangprasert A., Maehigashi T., Miles SJ., Giridharan N., Liu JX., Dunham CM., 2014, Mechanisms of toxin inhibition and transcriptional repression by Escherichia coli DinJ-YafQ., J Biol Chem. 289(30):20559-69

 [12] Weel-Sneve R., Kristiansen KI., Odsbu I., Dalhus B., Booth J., Rognes T., Skarstad K., Bjoras M., 2013, Single Transmembrane Peptide DinQ Modulates Membrane-Dependent Activities., PLoS Genet. 9(2):e1003260

 [13] Dorazi R., Dewar SJ., 2000, The SOS promoter dinH is essential for ftsK transcription during cell division., Microbiology. 146 ( Pt 11):2891-9

 [14] Ishino F., Jung HK., Ikeda M., Doi M., Wachi M., Matsuhashi M., 1989, New mutations fts-36, lts-33, and ftsW clustered in the mra region of the Escherichia coli chromosome induce thermosensitive cell growth and division., J Bacteriol. 171(10):5523-30

 [15] Vicente M., Gomez MJ., Ayala JA., 1998, Regulation of transcription of cell division genes in the Escherichia coli dcw cluster., Cell Mol Life Sci. 54(4):317-24

 [16] Little JW., Mount DW., Yanisch-Perron CR., 1981, Purified lexA protein is a repressor of the recA and lexA genes., Proc Natl Acad Sci U S A. 78(7):4199-203

 [17] Brent R., Ptashne M., 1981, Mechanism of action of the lexA gene product., Proc Natl Acad Sci U S A. 78(7):4204-8

 [18] Payne NS., Sancar A., 1989, The LexA protein does not bind specifically to the two SOS box-like sequences immediately 5' to the phr gene., Mutat Res. 218(3):207-10

 [19] Ma C., Rupert CS., 1995, Promoters of the phr gene in Escherichia coli K-12., Mol Gen Genet. 248(1):52-8

 [20] Rostas K., Morton SJ., Picksley SM., Lloyd RG., 1987, Nucleotide sequence and LexA regulation of the Escherichia coli recN gene., Nucleic Acids Res. 15(13):5041-9

 [21] Lupski JR., Ruiz AA., Godson GN., 1984, Promotion, termination, and anti-termination in the rpsU-dnaG-rpoD macromolecular synthesis operon of E. coli K-12., Mol Gen Genet. 195(3):391-401

 [22] Lupski JR., Smiley BL., Godson GN., 1983, Regulation of the rpsU-dnaG-rpoD macromolecular synthesis operon and the initiation of DNA replication in Escherichia coli K-12., Mol Gen Genet. 189(1):48-57

 [23] Benson FE., Illing GT., Sharples GJ., Lloyd RG., 1988, Nucleotide sequencing of the ruv region of Escherichia coli K-12 reveals a LexA regulated operon encoding two genes., Nucleic Acids Res. 16(4):1541-9

 [24] Shinagawa H., Makino K., Amemura M., Kimura S., Iwasaki H., Nakata A., 1988, Structure and regulation of the Escherichia coli ruv operon involved in DNA repair and recombination., J Bacteriol. 170(9):4322-9

 [25] Baquero MR., Bouzon M., Varea J., Moreno F., 1995, sbmC, a stationary-phase induced SOS Escherichia coli gene, whose product protects cells from the DNA replication inhibitor microcin B17., Mol Microbiol. 18(2):301-11

 [26] Brandsma JA., Bosch D., de Ruyter M., van de Putte P., 1985, Analysis of the regulatory region of the ssb gene of Escherichia coli., Nucleic Acids Res. 13(14):5095-109

 [27] Sancar A., Sancar GB., Rupp WD., Little JW., Mount DW., 1982, LexA protein inhibits transcription of the E. coli uvrA gene in vitro., Nature. 298(5869):96-8

 [28] Mizusawa S., Court D., Gottesman S., 1983, Transcription of the sulA gene and repression by LexA., J Mol Biol. 171(3):337-43

 [29] Vogel J., Argaman L., Wagner EG., Altuvia S., 2004, The small RNA IstR inhibits synthesis of an SOS-induced toxic peptide., Curr Biol. 14(24):2271-6

 [30] Kitagawa Y., Akaboshi E., Shinagawa H., Horii T., Ogawa H., Kato T., 1985, Structural analysis of the umu operon required for inducible mutagenesis in Escherichia coli., Proc Natl Acad Sci U S A. 82(13):4336-40

 [31] Otsuka J., Watanabe H., Mori KT., 1996, Evolution of transcriptional regulation system through promiscuous coupling of regulatory proteins with operons; suggestion from protein sequence similarities in Escherichia coli., J Theor Biol. 178(2):183-204

 [32] Sancar GB., Sancar A., Little JW., Rupp WD., 1982, The uvrB gene of Escherichia coli has both lexA-repressed and lexA-independent promoters., Cell. 28(3):523-30

 [33] Stark T., Moses RE., 1989, Interaction of the LexA repressor and the uvrC regulatory region., FEBS Lett. 258(1):39-41

 [34] Easton AM., Kushner SR., 1983, Transcription of the uvrD gene of Escherichia coli is controlled by the lexA repressor and by attenuation., Nucleic Acids Res. 11(24):8625-40

 [35] Christensen-Dalsgaard M., Jorgensen MG., Gerdes K., 2010, Three new RelE-homologous mRNA interferases of Escherichia coli differentially induced by environmental stresses., Mol Microbiol. 75(2):333-48

 [36] Lomba MR., Vasconcelos AT., Pacheco AB., de Almeida DF., 1997, Identification of yebG as a DNA damage-inducible Escherichia coli gene., FEMS Microbiol Lett. 156(1):119-22



RegulonDB