![]() ![]() |
Synonyms: LeuO |
Summary:
LeuO is a dual transcriptional regulator that regulates genes involved in leucine biosynthesis [1], genes involved in the utilization of certain β-glucosides [5, 7] and genes encoding LuxR-type transcription factors [16] It is also involved in the bacterial stringent response []. LeuO is one of the transcription factors that counteracts H-NS-mediated repression of specific loci [1, 5, 7, 12] Overproduction of LeuO causes the phenotype Bgl+, since LeuO can unsilence the bglGFB operon, which is silenced (phenotypically Bgl ) under laboratory conditions [7] LeuO is part of the RpoS/H-NS/Hfq/LeuO/DsrA RNA regulatory cascade that controls the bglGFH operon [5]and translation of rpoS, particularly at low temperatures []. LeuO belongs to the LysR transcriptional regulator family and contains a helix-turn-helix DNA-binding domain [4, 7] No LeuO consensus binding sequence is known [16]. LeuO activates transcription of the divergent leuLABCD operon [2]. An in vivo genetic selection (SELEX) and phenotype microarray analysis revealed several multidrug resistance genes as targets for LeuO, including acrEF, ygcLKJIH-ygbTF, and mdtNOP (sdsRQP). Read more > |
Transcription factor | ![]() ![]() |
||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||
Evolutionary Family: | LysR | ||||||||||||
Sensing class: | Using internal synthesized signals | ||||||||||||
Connectivity class: | Local Regulator | ||||||||||||
Gene name: | leuO | ||||||||||||
Genome position: | 84368-85312 | ||||||||||||
Length: | 945 bp / 314 aa | ||||||||||||
Operon name: | leuO | ||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | bglB, bglF, bglG, bglJ, cadC, cas1, cas2, casA, casB, casC, casD, casE, dsrA, leuA, leuB, leuC, leuD, leuL, leuO, yjjQ | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
defense/survival (7)
leucine (6)
carbon compounds (4)
Transcription related (4)
activator (4)
Read more >
|
||||||
Regulated operon(s) | bglGFB, cadC, casABCDE12, dsrA, leuLABCD, leuO, yjjQ-bglJ | ||||||
First gene in the operon(s) | bglG, cadC, casA, dsrA, leuL, leuO, yjjQ | ||||||
Simple and complex regulons | CRP,Fis,H-NS,LeuO,RcsB-BglJ,StpA CRP,H-NS,LeuO,SlyA CadC,FNR,H-NS,LeuO,MlrA,OmpR DksA-ppGpp,LeuO H-NS,LeuO Read more > | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
LeuO | activator | bglGp | nd | -149.0 | -279.0 | bglG, bglF, bglB |
atagcgacaaATAATTCACCAGACAAATCCCaataacttaa
|
3906836 | 3906856 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [5], [7], [9] | |
LeuO | activator | bglGp | nd | -118.0 | -248.0 | bglG, bglF, bglB |
aataacttaaTTATTGGGATTTGTTATATATaactttataa
|
3906805 | 3906825 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [5], [7], [9] | |
LeuO | repressor | cadCp | Sigma70 | nd | nd | cadC | nd | nd | [GEA] | [6] | ||
LeuO | activator | casAp | Sigma70 | -110.0 | -291.0 | casA, casB, casC, casD, casE, cas1, cas2 |
tatgagatttTATATTCACAGTATGAATATTttatgtaata
|
2884419 | 2884439 | [AIBSCS], [BPP], [CV(CHIP-SV/GEA/GS)], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/GS)], [CV(GEA/ROMA)], , [GEA], [GS], [IC] | [10], [11], [12], [13], [14] | |
LeuO | activator | casAp | Sigma70 | -80.0 | -261.0 | casA, casB, casC, casD, casE, cas1, cas2 |
tttatgtaatAAAATTCATGGTAATTATTATaactaaaagt
|
2884389 | 2884409 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [10], [14] | |
LeuO | activator | casAp | Sigma70 | 21.0 | -161.0 | casA, casB, casC, casD, casE, cas1, cas2 |
acaattcaacACATCTTAATATATGTATAGGttaattgtat
|
2884289 | 2884309 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [10], [14] | |
LeuO | activator | casAp | Sigma70 | 47.0 | -135.0 | casA, casB, casC, casD, casE, cas1, cas2 |
ataggttaatTGTATTAAACCAATGAATATAtttttgcagt
|
2884263 | 2884283 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [10], [14] | |
LeuO | repressor | dsrAp | Sigma70 | nd | nd | dsrA | nd | nd | [GEA] | [15] | ||
LeuO | activator | leuLp | Sigma70 | nd | nd | leuL, leuA, leuB, leuC, leuD | nd | nd | [GEA] | [2] | ||
LeuO | activator | leuOp | Sigma70 | -56.0 | -236.0 | leuO |
tagatgattgAGTATTCGCGGTAGTTATGATtagattgttt
|
84122 | 84142 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [1], [13] | |
LeuO | activator | leuOp2 | nd | -280.0 | -344.0 | leuO |
gattttttttGATATTGATTTGGTGAATATTattgatcaat
|
84014 | 84034 | [AIBSCS], [BPP], [CV(CHIP-SV/GEA/GS)], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/GS)], [CV(GEA/ROMA)], [GEA], [GS], [IC] | [11], [12], [13] | |
LeuO | repressor | leuOp2 | nd | -280.0 | -344.0 | leuO |
gattttttttGATATTGATTTGGTGAATATTattgatcaat
|
84014 | 84034 | [AIBSCS], [BPP], [CV(CHIP-SV/GEA/GS)], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/GS)], [CV(GEA/ROMA)], [GEA], [GS], [IC] | [11], [12], [13] | |
LeuO | activator | leuOp2 | nd | -254.0 | -318.0 | leuO |
atattattgaTCAATTAATGTTAAGAATTAAtgcattaaat
|
84040 | 84060 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [13] | |
LeuO | repressor | leuOp2 | nd | -254.0 | -318.0 | leuO |
atattattgaTCAATTAATGTTAAGAATTAAtgcattaaat
|
84040 | 84060 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [13] | |
LeuO | activator | leuOp2 | nd | -195.0 | -259.0 | leuO |
ataagcacatTTAATCCATTTTGTAGATGATtgagtattcg
|
84099 | 84119 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [13] | |
LeuO | repressor | leuOp2 | nd | -195.0 | -259.0 | leuO |
ataagcacatTTAATCCATTTTGTAGATGATtgagtattcg
|
84099 | 84119 | [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] | [13] | |
LeuO | activator | leuOp2 | nd | -172.0 | -236.0 | leuO |
tagatgattgAGTATTCGCGGTAGTTATGATtagattgttt
|
84122 | 84142 | [BPP], [GEA] | [1], [13] | |
LeuO | repressor | leuOp2 | nd | -172.0 | -236.0 | leuO |
tagatgattgAGTATTCGCGGTAGTTATGATtagattgttt
|
84122 | 84142 | [BPP], [GEA] | [1], [13] | |
LeuO | activator | yjjQp | Sigma70 | nd | nd | yjjQ, bglJ | nd | nd | [BPP] | [16] |
Functional conformation | Function | Object name | Object type | Distance to first Gene | Sequence | LeftPos | RightPos | Center Position | Growth Condition | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
LeuO | repressor | nd | tu | nd |
ttaaatatccATTAAAAATATTTATTTGGTTAATATGTTTTTAtgaaagcgta
|
3134072 | 3134105 | 3134088.0 | nd | [AIBSCS], , [GS] | [11], [12], [13] | |
LeuO | repressor | ybeQ | tu | nd |
atataatttaTCCTTAAATATTCATTAAATGAATATTAGCCGCattgcgaggc
|
676670 | 676703 | 676686.0 | nd | [AIBSCS], , [GS] | [11], [12], [13] | |
LeuO | repressor | gltF | tu | nd |
aaattgtctcGATATTAATATACAAAATATGAATATAAAAAACcaatatatta
|
3360885 | 3360918 | 3360901.0 | nd | [AIBSCS], , [GS] | [11], [12], [13] |
Alignment and PSSM for LeuO TFBSs | ![]() |
---|
Aligned TFBS of LeuO |
---|
Sequence | |
---|---|
ATAATTACCATGAATTTTATTAC | |
ATTCATACTGTGAATATAAAATC | |
ATTTGTCTGGTGAATTATTTGTC | |
ATTAAACCAATGAATATATTTTT | |
ATTGATTTGGTGAATATTATTGA | |
ATAACTACCGCGAATACTCAATC | |
ATTCTTAACATTAATTGATCAAT | |
TTAATTATTGGGATTTGTTATAT | |
ATCTACAAAATGGATTAAATGTG | |
ATACATATATTAAGATGTGTTGA |
Position weight matrix (PWM). LeuO matrix-quality result |
---|
A 9 0 4 4 5 1 7 2 3 4 0 1 9 8 1 4 2 4 4 3 3 3 2 C 0 0 1 3 1 1 2 4 3 0 1 0 0 0 0 0 1 0 1 1 0 0 4 G 0 0 0 1 1 0 0 0 2 5 1 8 1 1 0 0 3 0 1 0 2 2 1 T 1 10 5 2 3 8 1 4 2 1 8 1 0 1 9 6 4 6 4 6 5 5 3 |
Consensus |
---|
; consensus.strict ATtcataccgtGAaTtgtatttc ; consensus.strict.rc GAAATACAATTCACGGTATGAAT ; consensus.IUPAC ATwmwtaymrtGAaTwkwwwwwy ; consensus.IUPAC.rc RWWWWWMWATTCAYKRTAWKWAT ; consensus.regexp AT[at][ac][at]ta[ct][ac][ag]tGAaT[at][gt][at][at][at][at][at][ct] ; consensus.regexp.rc [AG][AT][AT][AT][AT][AT][AC][AT]ATTCA[CT][GT][AG]TA[AT][GT][AT]AT |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|