RegulonDB RegulonDB 10.8:Regulon Page
   

LeuO DNA-binding transcriptional dual regulator

Synonyms: LeuO
Summary:
LeuO is a dual transcriptional regulator that regulates genes involved in leucine biosynthesis [1], genes involved in the utilization of certain β-glucosides [5, 7] and genes encoding LuxR-type transcription factors [16] It is also involved in the bacterial stringent response []. LeuO is one of the transcription factors that counteracts H-NS-mediated repression of specific loci [1, 5, 7, 12] Overproduction of LeuO causes the phenotype Bgl+, since LeuO can unsilence the bglGFB operon, which is silenced (phenotypically Bgl ) under laboratory conditions [7] LeuO is part of the RpoS/H-NS/Hfq/LeuO/DsrA RNA regulatory cascade that controls the bglGFH operon [5]and translation of rpoS, particularly at low temperatures []. LeuO belongs to the LysR transcriptional regulator family and contains a helix-turn-helix DNA-binding domain [4, 7] No LeuO consensus binding sequence is known [16]. LeuO activates transcription of the divergent leuLABCD operon [2]. An in vivo genetic selection (SELEX) and phenotype microarray analysis revealed several multidrug resistance genes as targets for LeuO, including acrEF, ygcLKJIH-ygbTF, and mdtNOP (sdsRQP).
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
LeuO Functional   [APPH], [GEA], [IE] [1], [2], [3], [4], [5], [6], [7], [8]
Evolutionary Family: LysR
Sensing class: Using internal synthesized signals
Connectivity class: Local Regulator
Gene name: leuO
  Genome position: 84368-85312
  Length: 945 bp / 314 aa
Operon name: leuO
TU(s) encoding the TF:
Transcription unit        Promoter
leuO
leuOp
leuO
leuOp1
leuO
leuOp2
leuO
leuOp3


Regulon       
Regulated gene(s) bglB, bglF, bglG, bglJ, cadC, cas1, cas2, casA, casB, casC, casD, casE, dsrA, leuA, leuB, leuC, leuD, leuL, leuO, yjjQ
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
defense/survival (7)
leucine (6)
carbon compounds (4)
Transcription related (4)
activator (4)
Read more >
Regulated operon(s) bglGFB, cadC, casABCDE12, dsrA, leuLABCD, leuO, yjjQ-bglJ
First gene in the operon(s) bglG, cadC, casA, dsrA, leuL, leuO, yjjQ
Simple and complex regulons CRP,Fis,H-NS,LeuO,RcsB-BglJ,StpA
CRP,H-NS,LeuO,SlyA
CadC,FNR,H-NS,LeuO,MlrA,OmpR
DksA-ppGpp,LeuO
H-NS,LeuO
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[LeuO,+](6)
[LeuO,-](3)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  LeuO activator bglGp nd -149.0 -279.0 bglG, bglF, bglB
atagcgacaaATAATTCACCAGACAAATCCCaataacttaa
 3906836 3906856 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [5], [7], [9]
  LeuO activator bglGp nd -118.0 -248.0 bglG, bglF, bglB
aataacttaaTTATTGGGATTTGTTATATATaactttataa
 3906805 3906825 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [5], [7], [9]
  LeuO repressor cadCp Sigma70 nd nd cadC
nd
 nd nd [GEA] [6]
  LeuO activator casAp Sigma70 -110.0 -291.0 casA, casB, casC, casD, casE, cas1, cas2
tatgagatttTATATTCACAGTATGAATATTttatgtaata
 2884419 2884439 [AIBSCS], [BPP], [CV(CHIP-SV/GEA/GS)], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/GS)], [CV(GEA/ROMA)], , [GEA], [GS], [IC] [10], [11], [12], [13], [14]
  LeuO activator casAp Sigma70 -80.0 -261.0 casA, casB, casC, casD, casE, cas1, cas2
tttatgtaatAAAATTCATGGTAATTATTATaactaaaagt
 2884389 2884409 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [10], [14]
  LeuO activator casAp Sigma70 21.0 -161.0 casA, casB, casC, casD, casE, cas1, cas2
acaattcaacACATCTTAATATATGTATAGGttaattgtat
 2884289 2884309 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [10], [14]
  LeuO activator casAp Sigma70 47.0 -135.0 casA, casB, casC, casD, casE, cas1, cas2
ataggttaatTGTATTAAACCAATGAATATAtttttgcagt
 2884263 2884283 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [10], [14]
  LeuO repressor dsrAp Sigma70 nd nd dsrA
nd
 nd nd [GEA] [15]
  LeuO activator leuLp Sigma70 nd nd leuL, leuA, leuB, leuC, leuD
nd
 nd nd [GEA] [2]
  LeuO activator leuOp Sigma70 -56.0 -236.0 leuO
tagatgattgAGTATTCGCGGTAGTTATGATtagattgttt
 84122 84142 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [1], [13]
  LeuO activator leuOp2 nd -280.0 -344.0 leuO
gattttttttGATATTGATTTGGTGAATATTattgatcaat
 84014 84034 [AIBSCS], [BPP], [CV(CHIP-SV/GEA/GS)], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/GS)], [CV(GEA/ROMA)], [GEA], [GS], [IC] [11], [12], [13]
  LeuO repressor leuOp2 nd -280.0 -344.0 leuO
gattttttttGATATTGATTTGGTGAATATTattgatcaat
 84014 84034 [AIBSCS], [BPP], [CV(CHIP-SV/GEA/GS)], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/GS)], [CV(GEA/ROMA)], [GEA], [GS], [IC] [11], [12], [13]
  LeuO activator leuOp2 nd -254.0 -318.0 leuO
atattattgaTCAATTAATGTTAAGAATTAAtgcattaaat
 84040 84060 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [13]
  LeuO repressor leuOp2 nd -254.0 -318.0 leuO
atattattgaTCAATTAATGTTAAGAATTAAtgcattaaat
 84040 84060 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [13]
  LeuO activator leuOp2 nd -195.0 -259.0 leuO
ataagcacatTTAATCCATTTTGTAGATGATtgagtattcg
 84099 84119 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [13]
  LeuO repressor leuOp2 nd -195.0 -259.0 leuO
ataagcacatTTAATCCATTTTGTAGATGATtgagtattcg
 84099 84119 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IC] [13]
  LeuO activator leuOp2 nd -172.0 -236.0 leuO
tagatgattgAGTATTCGCGGTAGTTATGATtagattgttt
 84122 84142 [BPP], [GEA] [1], [13]
  LeuO repressor leuOp2 nd -172.0 -236.0 leuO
tagatgattgAGTATTCGCGGTAGTTATGATtagattgttt
 84122 84142 [BPP], [GEA] [1], [13]
  LeuO activator yjjQp Sigma70 nd nd yjjQ, bglJ
nd
 nd nd [BPP] [16]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  LeuO repressor nd tu nd
ttaaatatccATTAAAAATATTTATTTGGTTAATATGTTTTTAtgaaagcgta
3134072 3134105 3134088.0 nd [AIBSCS], , [GS] [11], [12], [13]
  LeuO repressor ybeQ tu nd
atataatttaTCCTTAAATATTCATTAAATGAATATTAGCCGCattgcgaggc
676670 676703 676686.0 nd [AIBSCS], , [GS] [11], [12], [13]
  LeuO repressor gltF tu nd
aaattgtctcGATATTAATATACAAAATATGAATATAAAAAACcaatatatta
3360885 3360918 3360901.0 nd [AIBSCS], , [GS] [11], [12], [13]
Other High-throughput regulatory interactions with weak evidence


Alignment and PSSM for LeuO TFBSs    

Aligned TFBS of LeuO   
  Sequence
  ATAATTACCATGAATTTTATTAC
  ATTCATACTGTGAATATAAAATC
  ATTTGTCTGGTGAATTATTTGTC
  ATTAAACCAATGAATATATTTTT
  ATTGATTTGGTGAATATTATTGA
  ATAACTACCGCGAATACTCAATC
  ATTCTTAACATTAATTGATCAAT
  TTAATTATTGGGATTTGTTATAT
  ATCTACAAAATGGATTAAATGTG
  ATACATATATTAAGATGTGTTGA

Position weight matrix (PWM). LeuO matrix-quality result    
A	9	0	4	4	5	1	7	2	3	4	0	1	9	8	1	4	2	4	4	3	3	3	2
C	0	0	1	3	1	1	2	4	3	0	1	0	0	0	0	0	1	0	1	1	0	0	4
G	0	0	0	1	1	0	0	0	2	5	1	8	1	1	0	0	3	0	1	0	2	2	1
T	1	10	5	2	3	8	1	4	2	1	8	1	0	1	9	6	4	6	4	6	5	5	3

Consensus    
;	consensus.strict             	ATtcataccgtGAaTtgtatttc
;	consensus.strict.rc          	GAAATACAATTCACGGTATGAAT
;	consensus.IUPAC              	ATwmwtaymrtGAaTwkwwwwwy
;	consensus.IUPAC.rc           	RWWWWWMWATTCAYKRTAWKWAT
;	consensus.regexp             	AT[at][ac][at]ta[ct][ac][ag]tGAaT[at][gt][at][at][at][at][at][ct]
;	consensus.regexp.rc          	[AG][AT][AT][AT][AT][AT][AC][AT]ATTCA[CT][GT][AG]TA[AT][GT][AT]AT

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [APPH] Assay of protein purified to homogeneity

 [GEA] Gene expression analysis

 [IE] Inferred from experiment

 [BPP] Binding of purified proteins

 [CV(CHIP-SV/GEA/ROMA)] cross validation(CHIP-SV/GEA/ROMA)

 [CV(GEA/ROMA)] cross validation(GEA/ROMA)

 [IC] Inferred by curator

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [CV(CHIP-SV/GEA/GS)] cross validation(CHIP-SV/GEA/GS)

 [CV(GEA/GS)] cross validation(GEA/GS)

 [EME] Expression microarray evidence

 [GS] genomic SELEX


Reference(s)    

 [1] Chen CC., Chou MY., Huang CH., Majumder A., Wu HY., 2005, A cis-spreading nucleoprotein filament is responsible for the gene silencing activity found in the promoter relay mechanism., J Biol Chem 280(6):5101-12

 [2] Chen CC., Fang M., Majumder A., Wu HY., 2001, A 72-base pair AT-rich DNA sequence element functions as a bacterial gene silencer., J Biol Chem 276(12):9478-85

 [3] Haughn GW., Wessler SR., Gemmill RM., Calvo JM., 1986, High A + T content conserved in DNA sequences upstream of leuABCD in Escherichia coli and Salmonella typhimurium., J Bacteriol 166(3):1113-7

 [4] Henikoff S., Haughn GW., Calvo JM., Wallace JC., 1988, A large family of bacterial activator proteins., Proc Natl Acad Sci U S A 85(18):6602-6

 [5] Madhusudan S., Paukner A., Klingen Y., Schnetz K., 2005, Independent regulation of H-NS-mediated silencing of the bgl operon at two levels: upstream by BglJ and LeuO and downstream by DnaKJ., Microbiology 151(Pt 10):3349-59

 [6] Shi X., Bennett GN., 1995, Effects of multicopy LeuO on the expression of the acid-inducible lysine decarboxylase gene in Escherichia coli., J Bacteriol 177(3):810-4

 [7] Ueguchi C., Ohta T., Seto C., Suzuki T., Mizuno T., 1998, The leuO gene product has a latent ability to relieve bgl silencing in Escherichia coli., J Bacteriol 180(1):190-3

 [8] Yura T., Mori H., Nagai H., Nagata T., Ishihama A., Fujita N., Isono K., Mizobuchi K., Nakata A., 1992, Systematic sequencing of the Escherichia coli genome: analysis of the 0-2.4 min region., Nucleic Acids Res 20(13):3305-8

 [9] Venkatesh GR., Kembou Koungni FC., Paukner A., Stratmann T., Blissenbach B., Schnetz K., 2010, BglJ-RcsB heterodimers relieve repression of the Escherichia coli bgl operon by H-NS., J Bacteriol 192(24):6456-64

 [10] Arslan Z., Stratmann T., Wurm R., Wagner R., Schnetz K., Pul U., 2013, RcsB-BglJ-mediated activation of Cascade operon does not induce the maturation of CRISPR RNAs in E. coli K12., RNA Biol 10(5):708-15

 [11] Fragel SM., Montada A., Heermann R., Baumann U., Schacherl M., Schnetz K., 2019, Characterization of the pleiotropic LysR-type transcription regulator LeuO of Escherichia coli., Nucleic Acids Res 47(14):7363-7379

 [12] Shimada T., Bridier A., Briandet R., Ishihama A., 2011, Novel roles of LeuO in transcription regulation of E. coli genome: antagonistic interplay with the universal silencer H-NS., Mol Microbiol 82(2):378-97

 [13] Stratmann T., Pul U., Wurm R., Wagner R., Schnetz K., 2012, RcsB-BglJ activates the Escherichia coli leuO gene, encoding an H-NS antagonist and pleiotropic regulator of virulence determinants., Mol Microbiol 83(6):1109-23

 [14] Westra ER., Pul U., Heidrich N., Jore MM., Lundgren M., Stratmann T., Wurm R., Raine A., Mescher M., Van Heereveld L., Mastop M., Wagner EG., Schnetz K., Van Der Oost J., Wagner R., Brouns SJ., 2010, H-NS-mediated repression of CRISPR-based immunity in Escherichia coli K12 can be relieved by the transcription activator LeuO., Mol Microbiol 77(6):1380-93

 [15] Repoila F., Gottesman S., 2001, Signal transduction cascade for regulation of RpoS: temperature regulation of DsrA., J Bacteriol 183(13):4012-23

 [16] Stratmann T., Madhusudan S., Schnetz K., 2008, Regulation of the yjjQ-bglJ operon, encoding LuxR-type transcription factors, and the divergent yjjP gene by H-NS and LeuO., J Bacteriol 190(3):926-35


RegulonDB