![]() ![]() |
Synonyms: SoxR, SoxR-[2Fe-2S]3+ oxydized, SoxR-[2Fe-2S]2+ reduced |
Summary:
The SoxR protein, for "Superoxide Response protein," is negatively autoregulated and controls the transcription of the regulon involved in defense against redox-cycling drugs [5, 6, 7, 8] and in responses to nitric oxide [3, 9, 10, 11, 12, 13, 14, 15, 16, 17]. SoxR belongs to the MerR family and is a homodimer in solution [1, 18]. SoxR contains two essential [2Fe-2S] clusters for its transcriptional activity [19]. Each SoxR polypeptide contains a [2Fe-2S] cluster that senses the oxidants in the cell. Both Fe-SoxR and apo-SoxR bind to the promoter region, but only Fe-SoxR contributes to the activation in its oxidized form [1, 18, 20, 21, 22]. The redox state of the iron-sulfur cluster regulates SoxR activity [23, 24]. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||||||||
Evolutionary Family: | MerR | ||||||||||||||||||||||||
Sensing class: | Using internal synthesized signals | ||||||||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||||||||
Gene name: | soxR | ||||||||||||||||||||||||
Genome position: | 4277469-4277933 | ||||||||||||||||||||||||
Length: | 465 bp / 154 aa | ||||||||||||||||||||||||
Operon name: | soxR | ||||||||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | aroF, fumC, sodA, soxR, soxS, tyrA, yjcB, yrbL | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
detoxification (3)
Transcription related (2)
activator (2)
repressor (2)
other (mechanical, nutritional, oxidative stress) (2)
Read more >
|
||||||
Regulated operon(s) | aroF-tyrA, fumAC, sodA, soxR, soxS, yjcB, yrbL | ||||||
First gene in the operon(s) | aroF, fumC, sodA, soxR, soxS, yjcB, yrbL | ||||||
Simple and complex regulons | AcrR,FNR,Fur,SoxR AcrR,FNR,Fur,SoxR,SoxS ArcA,CRP,FNR,Fur,IHF,MarA,Rob,SoxR,SoxS ArcA,CRP,FNR,Fur,MarA,SoxR,SoxS BasR,PhoP,SoxR,SoxS Read more > | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
SoxR | activator | aroFp | Sigma70 | 8.5 | -43.5 | aroF, tyrA |
atcgttacgtCATCCTCGCTGAGGATCAactatcgcaa
|
2741185 | 2741202 | [RSE], [CEEUMA], [IHBCE] | [2] | |
SoxR | activator | fumCp2 | Sigma38 | nd | nd | fumC | nd | nd | [GEA], [BPP] | [3] | ||
SoxR | activator | sodAp | Sigma70 | 9.0 | -43.0 | sodA |
ataatgaaccAACTGCTTACGCGGCATTaacaatcggc
|
4100758 | 4100775 | [RSE], [CEEUMA], [IHBCE] | [2] | |
SoxR | repressor | soxRp | Sigma70 | 2.5 | -20.5 | soxR |
gagtataattCCTCAAGTTAACTTGAGGtaaagcgatt
|
4277440 | 4277457 | [GEA], [RSE], [BPP], [CEEUMA], [IHBCE] | [1], [2], [4] | |
SoxR | activator | soxSp | Sigma70 | -25.5 | -65.5 | soxS |
aatcgctttaCCTCAAGTTAACTTGAGGaattatactc
|
4277440 | 4277457 | [GEA], [RSE], [BPP], [CEEUMA], [IHBCE] | [1], [2], [4] | |
SoxR | activator | soxSp | Sigma70 | 6.0 | -35.0 | soxS |
tatactccccAACAGATGAATTAACGAActgaacactg
|
4277409 | 4277426 | [RSE], [CEEUMA], [IHBCE] | [2] | |
SoxR | activator | yjcBp | nd | -4.0 | -127.0 | yjcB |
gtgatatagtTCACAAAATTAATGAAACaaacagagtg
|
4275159 | 4275176 | [RSE], [CEEUMA], [IHBCE] | [2] | |
SoxR | activator | yrbLp | nd | 36.0 | 5.0 | yrbL |
tttccaggagATGGCATGATTCGCTTATctgaacaaag
|
3348447 | 3348464 | [RSE], [AIBSCS], [CEEUMA], [IHBCE], [RSE] | [2] |
Alignment and PSSM for SoxR TFBSs | ![]() |
---|
Aligned TFBS of SoxR |
---|
Sequence | |
---|---|
TACCTCAAGTTAACTTGAGG | |
TTCGTTAATTCATCTGTTGG | |
TACGTCATCCTCGCTGAGGA | |
AATGCCGCGTAAGCAGTTGG | |
TTTGTTTCATTAATTTTGTG | |
GATGGCATGATTCGCTTATC |
Position weight matrix (PWM). SoxR matrix-quality result |
---|
A 1 4 0 0 0 0 4 2 1 1 1 4 2 0 1 0 1 2 0 1 C 0 0 3 1 1 4 0 2 1 1 1 1 1 4 1 0 0 0 0 1 G 1 0 0 5 1 0 1 0 3 0 0 0 2 1 0 3 1 2 4 4 T 4 2 3 0 4 2 1 2 1 4 4 1 1 1 4 3 4 2 2 0 |
Consensus |
---|
; consensus.strict tacGtCacgttagCtgtgGG ; consensus.strict.rc CCCACAGCTAACGTGACGTA ; consensus.IUPAC twyGtYahgttarCtktdKG ; consensus.IUPAC.rc CMHAMAGYTAACDTRACRWA ; consensus.regexp t[at][ct]Gt[CT]a[act]gtta[ag]Ct[gt]t[agt][GT]G ; consensus.regexp.rc C[AC][ACT]A[AC]AG[CT]TAAC[AGT]T[AG]AC[AG][AT]A |
Evolutionary conservation of regulatory elements | ![]() |
---|