![]() ![]() |
Synonyms: XylR, XylR-α-D-xylopyranose |
Summary:
"Xylose regulator," XylR, is a transcription factor involved in d-xylose degradation. It coregulates with CRP, a global transcriptional regulator [3] These regulators bind cooperatively to activate transcription of operons involved in transport and catabolism of D-xylose. Synthesis of these operons is induced when Escherichia coli is grown on D-xylose in the absence of glucose. Gene induction occurs when the physiological inducer, D-xylose, binds to XylR and when cellular cyclic AMP levels are high [3] XylR also has a regulatory role in the cellular resumption of growth during the metabolic switching from glucose to xylose [5]. When XylR is overexpressed the duration of the lag phase is reduced, and when it is titrated the duration of the lag phase is extended [5]. In the presence of d-xylose, XylR binds in tandem to four inverted repeat sequences in the xylAB/xylFGHR intergenic region to activate transcription by overlapping the -35 boxes of xylABp and xylFGHRp [3] The binding targets for XylR consist of 18-nucleotide-long directed repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [3, 6] XylR belongs to the AraC/XylS family [7, 8] Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | AraC/XylS | ||||||||||||||||||
Sensing class: | External sensing using transported metabolites | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | xylR | ||||||||||||||||||
Genome position: | 3734979-3736157 | ||||||||||||||||||
Length: | 1179 bp / 392 aa | ||||||||||||||||||
Operon name: | xylFGHR | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | araC, xylA, xylB, xylE, xylF, xylG, xylH, xylR | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Transcription related (2)
activator (2)
operon (2)
membrane (2)
Read more >
|
||||||
Regulated operon(s) | araC, xylAB, xylE, xylFGHR | ||||||
First gene in the operon(s) | araC, xylA, xylE, xylF | ||||||
Simple and complex regulons | AraC,CRP,XylR CRP,Fis,XylR CRP,XylR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence![]() |
LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
XylR-α-D-xylopyranose | repressor | araCp | Sigma70 | -19.5 | -183.5 | araC |
gtggacttttCTGCCGTGATTATAGACACttttgttacg
|
70195 | 70213 | [GEA], [AIBSCS], [BPP] | [2] | |
XylR-α-D-xylopyranose | repressor | araCp | Sigma70 | 2.5 | -162.5 | araC |
atagacacttTTGTTACGCGTTTTTGTCAtggctttggt
|
70216 | 70234 | [GEA], [AIBSCS], [BPP] | [2] | |
XylR-α-D-xylopyranose | activator | xylAp | nd | -62.5 | -104.5 | xylA, xylB |
agcgcacactTGTGAATTATCTCAATAGcagtgtgaaa
|
3730861 | 3730878 | [GEA], [APIORCISFBSCS], [BPP] | [3] | |
XylR-α-D-xylopyranose | activator | xylAp | nd | -41.5 | -83.5 | xylA, xylB |
tcaatagcagTGTGAAATAACATAATTGagcaactgaa
|
3730840 | 3730857 | [GEA], [APIORCISFBSCS], [BPP] | [3] | |
XylR-α-D-xylopyranose | activator | xylEp | Sigma70 | -65.0 | -102.0 | xylE |
taagatcacaGAAAAGACATTACGTAAacgcattgta
|
4242348 | 4242364 | [GEA], [AIBSCS], [BPP], [SM] | [4] | |
XylR-α-D-xylopyranose | activator | xylEp | Sigma70 | -44.0 | -81.0 | xylE |
acgtaaacgcATTGTAAAAAATGATAAttgccttaac
|
4242327 | 4242343 | [GEA], [AIBSCS], [BPP], [SM] | [4] | |
XylR-α-D-xylopyranose | activator | xylFp | nd | -61.5 | -123.5 | xylF, xylG, xylH, xylR |
tcaagaaataAACCAAAAATCGTAATCGaaagataaaa
|
3730999 | 3731016 | [GEA], [APIORCISFBSCS], [BPP] | [3] | |
XylR-α-D-xylopyranose | activator | xylFp | nd | -40.5 | -102.5 | xylF, xylG, xylH, xylR |
gtaatcgaaaGATAAAAATCTGTAATTGttttcccctg
|
3731020 | 3731037 | [GEA], [APIORCISFBSCS], [BPP] | [3] |
Alignment and PSSM for XylR TFBSs | ![]() |
---|
Aligned TFBS of XylR |
---|
Sequence | |
---|---|
CAGTGTGAAATAACATAATTG | |
CATTGTAAAAAATGATAATTG | |
ATAAACCAAAAATCGTAATCG | |
AAAGATAAAAATCTGTAATTG | |
ACTTGTGAATTATCTCAATAG | |
CATGACAAAAACGCGTAACAA | |
AAGTGTCTATAATCACGGCAG | |
AGAAAAGACATTACGTAAACG |
Position weight matrix (PWM). XylR matrix-quality result |
---|
A 5 5 3 2 4 1 3 7 7 6 5 5 2 0 3 0 7 7 1 3 1 C 3 1 0 0 0 2 2 0 1 0 0 1 1 6 0 2 0 0 2 2 0 G 0 1 2 2 4 0 3 0 0 0 0 0 1 1 4 0 1 1 0 0 7 T 0 1 3 4 0 5 0 1 0 2 3 2 4 1 1 6 0 0 5 3 0 |
Consensus |
---|
; consensus.strict aaatgtgAAaaatCgtAAtaG ; consensus.strict.rc CTATTACGATTTTTCACATTT ; consensus.IUPAC madkryvAAawatCryAAyhG ; consensus.IUPAC.rc CDRTTRYGATWTTTBRYMHTK ; consensus.regexp [ac]a[agt][gt][ag][ct][acg]AAa[at]atC[ag][ct]AA[ct][act]G ; consensus.regexp.rc C[AGT][AG]TT[AG][CT]GAT[AT]TTT[CGT][AG][CT][AC][ACT]T[GT] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|