RegulonDB RegulonDB 10.10:Regulon Page
   

XylR DNA-binding transcriptional dual regulator

Synonyms: XylR, XylR-α-D-xylopyranose
Summary:
"Xylose regulator," XylR, is a transcription factor involved in d-xylose degradation. It coregulates with CRP, a global transcriptional regulator [3] These regulators bind cooperatively to activate transcription of operons involved in transport and catabolism of D-xylose. Synthesis of these operons is induced when Escherichia coli is grown on D-xylose in the absence of glucose. Gene induction occurs when the physiological inducer, D-xylose, binds to XylR and when cellular cyclic AMP levels are high [3] XylR also has a regulatory role in the cellular resumption of growth during the metabolic switching from glucose to xylose [5]. When XylR is overexpressed the duration of the lag phase is reduced, and when it is titrated the duration of the lag phase is extended [5]. In the presence of d-xylose, XylR binds in tandem to four inverted repeat sequences in the xylAB/xylFGHR intergenic region to activate transcription by overlapping the -35 boxes of xylABp and xylFGHRp [3] The binding targets for XylR consist of 18-nucleotide-long directed repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [3, 6] XylR belongs to the AraC/XylS family [7, 8] Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
XylR Non-Functional   Apo [BPP], [GEA] [1]
XylR-α-D-xylopyranose Functional Allosteric Holo [BPP], [GEA] [1]
Evolutionary Family: AraC/XylS
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: xylR
  Genome position: 3734979-3736157
  Length: 1179 bp / 392 aa
Operon name: xylFGHR
TU(s) encoding the TF:
Transcription unit        Promoter
xylFGHR
xylFp
xylR
xylRp


Regulon       
Regulated gene(s) araC, xylA, xylB, xylE, xylF, xylG, xylH, xylR
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Transcription related (2)
activator (2)
operon (2)
membrane (2)
Read more >
Regulated operon(s) araC, xylAB, xylE, xylFGHR
First gene in the operon(s) araC, xylA, xylE, xylF
Simple and complex regulons AraC,CRP,XylR
CRP,Fis,XylR
CRP,XylR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[XylR,+](3)
[XylR,-](1)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
 LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  XylR-α-D-xylopyranose repressor araCp Sigma70 -19.5 -183.5 araC
gtggacttttCTGCCGTGATTATAGACACttttgttacg
 70195 70213 [GEA], [AIBSCS], [BPP] [2]
  XylR-α-D-xylopyranose repressor araCp Sigma70 2.5 -162.5 araC
atagacacttTTGTTACGCGTTTTTGTCAtggctttggt
 70216 70234 [GEA], [AIBSCS], [BPP] [2]
  XylR-α-D-xylopyranose activator xylAp nd -62.5 -104.5 xylA, xylB
agcgcacactTGTGAATTATCTCAATAGcagtgtgaaa
 3730861 3730878 [GEA], [APIORCISFBSCS], [BPP] [3]
  XylR-α-D-xylopyranose activator xylAp nd -41.5 -83.5 xylA, xylB
tcaatagcagTGTGAAATAACATAATTGagcaactgaa
 3730840 3730857 [GEA], [APIORCISFBSCS], [BPP] [3]
  XylR-α-D-xylopyranose activator xylEp Sigma70 -65.0 -102.0 xylE
taagatcacaGAAAAGACATTACGTAAacgcattgta
 4242348 4242364 [GEA], [AIBSCS], [BPP], [SM] [4]
  XylR-α-D-xylopyranose activator xylEp Sigma70 -44.0 -81.0 xylE
acgtaaacgcATTGTAAAAAATGATAAttgccttaac
 4242327 4242343 [GEA], [AIBSCS], [BPP], [SM] [4]
  XylR-α-D-xylopyranose activator xylFp nd -61.5 -123.5 xylF, xylG, xylH, xylR
tcaagaaataAACCAAAAATCGTAATCGaaagataaaa
 3730999 3731016 [GEA], [APIORCISFBSCS], [BPP] [3]
  XylR-α-D-xylopyranose activator xylFp nd -40.5 -102.5 xylF, xylG, xylH, xylR
gtaatcgaaaGATAAAAATCTGTAATTGttttcccctg
 3731020 3731037 [GEA], [APIORCISFBSCS], [BPP] [3]


Alignment and PSSM for XylR TFBSs    

Aligned TFBS of XylR   
  Sequence
  CAGTGTGAAATAACATAATTG
  CATTGTAAAAAATGATAATTG
  ATAAACCAAAAATCGTAATCG
  AAAGATAAAAATCTGTAATTG
  ACTTGTGAATTATCTCAATAG
  CATGACAAAAACGCGTAACAA
  AAGTGTCTATAATCACGGCAG
  AGAAAAGACATTACGTAAACG

Position weight matrix (PWM). XylR matrix-quality result    
A	5	5	3	2	4	1	3	7	7	6	5	5	2	0	3	0	7	7	1	3	1
C	3	1	0	0	0	2	2	0	1	0	0	1	1	6	0	2	0	0	2	2	0
G	0	1	2	2	4	0	3	0	0	0	0	0	1	1	4	0	1	1	0	0	7
T	0	1	3	4	0	5	0	1	0	2	3	2	4	1	1	6	0	0	5	3	0

Consensus    
;	consensus.strict             	aaatgtgAAaaatCgtAAtaG
;	consensus.strict.rc          	CTATTACGATTTTTCACATTT
;	consensus.IUPAC              	madkryvAAawatCryAAyhG
;	consensus.IUPAC.rc           	CDRTTRYGATWTTTBRYMHTK
;	consensus.regexp             	[ac]a[agt][gt][ag][ct][acg]AAa[at]atC[ag][ct]AA[ct][act]G
;	consensus.regexp.rc          	C[AGT][AG]TT[AG][CT]GAT[AT]TTT[CGT][AG][CT][AC][ACT]T[GT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [SM] Site mutation


Reference(s)    

 [1] Seeger C., Poulsen C., Dandanell G., 1995, Identification and characterization of genes (xapA, xapB, and xapR) involved in xanthosine catabolism in Escherichia coli., J Bacteriol 177(19):5506-16

 [2] Koirala S., Wang X., Rao CV., 2015, Reciprocal Regulation of l-Arabinose and d-Xylose Metabolism in Escherichia coli., J Bacteriol 198(3):386-93

 [3] Song S., Park C., 1997, Organization and regulation of the D-xylose operons in Escherichia coli K-12: XylR acts as a transcriptional activator., J Bacteriol 179(22):7025-32

 [4] Belliveau NM., Barnes SL., Ireland WT., Jones DL., Sweredoski MJ., Moradian A., Hess S., Kinney JB., Phillips R., 2018, Systematic approach for dissecting the molecular mechanisms of transcriptional regulation in bacteria., Proc Natl Acad Sci U S A 115(21):E4796-E4805

 [5] Barthe M, Tchouanti J, Gomes PH, Bideaux C, Lestrade D, Graham C, Steyer JP, Meleard S, Harmand J, Gorret N, Cocaign-Bousquet M, Enjalbert B, 2020, Availability of the Molecular Switch XylR Controls Phenotypic Heterogeneity and Lag Duration during Escherichia coli Adaptation from Glucose to Xylose., mBio, 11(6):None 10.1128/mBio.02938-20

 [6] Laikova ON., Mironov AA., Gelfand MS., 2001, Computational analysis of the transcriptional regulation of pentose utilization systems in the gamma subdivision of Proteobacteria., FEMS Microbiol Lett 205(2):315-22

 [7] Gallegos MT., Schleif R., Bairoch A., Hofmann K., Ramos JL., 1997, Arac/XylS family of transcriptional regulators., Microbiol Mol Biol Rev 61(4):393-410

 [8] Tobes R, Ramos JL, 2002, AraC-XylS database: a family of positive transcriptional regulators in bacteria., Nucleic Acids Res, 30(1):318 10.1093/nar/30.1.318


RegulonDB