RegulonDB RegulonDB 10.9:Regulon Page

XylR DNA-binding transcriptional dual regulator

Synonyms: XylR-α-D-xylopyranose, XylR
"Xylose regulator," XylR, is a transcription factor involved in D-xylose degradation. It coregulates with CRP, a global transcriptional regulator [3]. These regulators bind cooperatively to activate transcription of operons involved in transport and catabolism of d-xylose. Synthesis of these operons is induced when Escherichia coli is grown on D-xylose in the absence of glucose. Gene induction occurs when the physiological inducer, D-xylose, binds to XylR and when cellular cyclic AMP levels are high [3]. In the presence of D-xylose, XylR binds in tandem to four inverted repeat sequences in the xylAB/xylFGHR intergenic region to activate transcription by overlapping the -35 boxes of xylABp and xylFGHRp [3]. The binding targets for XylR consist of 18-nucleotide-long directed repeat sequences that possess conserved motifs; each monomer binds to one of these conserved sequences [3, 5].
Read more >

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
XylR Non-Functional   Apo [BPP], [GEA] [1]
XylR-α-D-xylopyranose Functional Allosteric Holo [APPH], [BPP], [GEA], [IEP] [1], [2], [3]
Evolutionary Family: AraC/XylS
Sensing class: External sensing using transported metabolites
Connectivity class: Local Regulator
Gene name: xylR
  Genome position: 3734979-3736157
  Length: 1179 bp / 392 aa
Operon name: xylFGHR
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) araC, xylA, xylB, xylE, xylF, xylG, xylH, xylR
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
carbon compounds (8)
Transcription related (2)
activator (2)
operon (2)
membrane (2)
Read more >
Regulated operon(s) araC, xylAB, xylE, xylFGHR
First gene in the operon(s) araC, xylA, xylE, xylF
Simple and complex regulons AraC,CRP,XylR
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  XylR-α-D-xylopyranose repressor araCp Sigma70 -19.5 -183.5 araC
70195 70213 [AIBSCS], [BPP], [GEA] [2]
  XylR-α-D-xylopyranose repressor araCp Sigma70 2.5 -162.5 araC
70216 70234 [AIBSCS], [BPP], [GEA] [2]
  XylR-α-D-xylopyranose activator xylAp nd -62.5 -104.5 xylA, xylB
3730861 3730878 [APIORCISFBSCS], [BPP], [GEA] [3]
  XylR-α-D-xylopyranose activator xylAp nd -41.5 -83.5 xylA, xylB
3730840 3730857 [APIORCISFBSCS], [BPP], [GEA] [3]
  XylR-α-D-xylopyranose activator xylEp Sigma70 -65.0 -102.0 xylE
4242348 4242364 [AIBSCS], [BPP], [GEA], [SM] [4]
  XylR-α-D-xylopyranose activator xylEp Sigma70 -44.0 -81.0 xylE
4242327 4242343 [AIBSCS], [BPP], [GEA], [SM] [4]
  XylR-α-D-xylopyranose activator xylFp nd -61.5 -123.5 xylF, xylG, xylH, xylR
3730999 3731016 [APIORCISFBSCS], [BPP], [GEA] [3]
  XylR-α-D-xylopyranose activator xylFp nd -40.5 -102.5 xylF, xylG, xylH, xylR
3731020 3731037 [APIORCISFBSCS], [BPP], [GEA] [3]

Alignment and PSSM for XylR TFBSs    

Aligned TFBS of XylR   

Position weight matrix (PWM). XylR matrix-quality result   
A	5	5	3	2	4	1	3	7	7	6	5	5	2	0	3	0	7	7	1	3	1
C	3	1	0	0	0	2	2	0	1	0	0	1	1	6	0	2	0	0	2	2	0
G	0	1	2	2	4	0	3	0	0	0	0	0	1	1	4	0	1	1	0	0	7
T	0	1	3	4	0	5	0	1	0	2	3	2	4	1	1	6	0	0	5	3	0

;	consensus.strict             	aaatgtgAAaaatCgtAAtaG
;	consensus.strict.rc          	CTATTACGATTTTTCACATTT
;	consensus.IUPAC              	madkryvAAawatCryAAyhG
;	consensus.IUPAC.rc           	CDRTTRYGATWTTTBRYMHTK
;	consensus.regexp             	[ac]a[agt][gt][ag][ct][acg]AAa[at]atC[ag][ct]AA[ct][act]G
;	consensus.regexp.rc          	C[AGT][AG]TT[AG][CT]GAT[AT]TTT[CGT][AG][CT][AC][ACT]T[GT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation
