RegulonDB RegulonDB 10.8:Regulon Page
   

RutR DNA-binding transcriptional dual regulator

Synonyms: RutR-thymine, RutR-uracil, RutR
Summary:
RutR regulates genes directly or indirectly involved in the complex pathway of pyrimidine metabolism [1, 3] and also plays a role in regulation of the genes for degradation of purines and genes for maintenance of pH homeostasis [3]. This protein belongs to the TetR family, whose members have an N-terminal DNA-binding domain that contains a helix-turn-helix motif and a C-terminal domain for dimerization and ligand binding []. RutR recognizes and binds a 16-bp (7-2-7) inverted repeat consensus sequence [3, 6], where the central A/T nucleotide in each half-site appears to be the most important for the site [6]. This binding is inhibited when uracil and thymine bind to RutR, although the effect is greater for uracil than for thymine [3].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
RutR Functional   Apo [AIFS], [APPH], [BPP], [HIFS], [IDA], [IEP], [IMP] [1], [2], [3]
RutR-thymine Non-Functional Allosteric Holo [BPP], [IDA], [IEP] [3]
RutR-uracil Non-Functional Allosteric Holo [APPINH], [BPP], [IDA], [IEP] [3], [4]
Evolutionary Family: TetR/AcrR
Connectivity class: Local Regulator
Gene name: rutR
  Genome position: 1074242-1074880
  Length: 639 bp / 212 aa
Operon name: rutR
TU(s) encoding the TF:
Transcription unit        Promoter
rutR
rutRp
rutR
rutRp2


Regulon       
Regulated gene(s) carA, carB, fepB, gadW, gadX, gloA, nemA, nemR, pdeR, rutA, rutB, rutC, rutD, rutE, rutF, rutG, rutR
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
nitrogen metabolism (6)
Transcription related (4)
arginine (2)
pyrimidine biosynthesis (2)
repressor (2)
Read more >
Regulated operon(s) carAB, fepB, gadAXW, nemRA-gloA, pdeR, rutABCDEFG, rutR
First gene in the operon(s) carA, fepB, gadX, gadX, nemR, nemR, pdeR, rutA, rutR
Simple and complex regulons ArcA,NtrC,PhoP,RutR
FNR,GadE,GadW,GadX,H-NS,PhoB,RutR
Fis,IHF,PepA,PurR,RutR
FliZ,RutR
Fur,RutR
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[RutR,+](1)
[RutR,-](6)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  RutR activator carAp1 Sigma70 -184.0 -284.0 carA, carB
aatgtaaattTTGACCATTTGGTCCACttttttctgc
 29359 29375 [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [3], [4], [5], [6]
  RutR repressor fepBp Sigma70 172.5 -45.5 fepB
gattgtgcgcTTTGTCGAATTTGTCATtacgccctta
 624548 624564 [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [6]
  RutR repressor gadXp Sigma38 -824.5 -853.5 gadX, gadW
ggtgttcaacGTTGACTACCTGGGTGGTCAAattggtactt
 3666654 3666674 [BPP], [GEA] [3]
  RutR repressor nemRp Sigma70 -20.5 -22.5 nemR, nemA, gloA
ttgcttgcacTAGACCGACTGGTCTACtacactccaa
 1725993 1726009 [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [6]
  RutR repressor pdeRp Sigma38 nd nd pdeR
nd
 nd nd [GEA] [3]
  RutR repressor rutAp Sigma54 -102.5 -117.5 rutA, rutB, rutC, rutD, rutE, rutF, rutG
atgtgcaactGTTTTGACCGTTTAGTCCActttttacca
 1074120 1074138 [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [3], [5], [6]
  RutR repressor rutRp2 Sigma70 16.5 -113.5 rutR
tggtaaaaagTGGACTAAACGGTCAAAACagttgcacat
 1074120 1074138 [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [3], [5], [6]


Alignment and PSSM for RutR TFBSs    

Aligned TFBS of RutR   
  Sequence
  TTGACCATTTGGTCCACTTT
  TTGACCGTTTAGTCCACTTT
  TAGACCGACTGGTCTACTAC
  CCACCCAGGTAGTCAACGTT
  ATGACAAATTCGACAAAGCG

Position weight matrix (PWM). RutR matrix-quality result    
A	1	1	1	4	0	1	3	2	0	0	2	0	1	0	2	5	1	0	1	0
C	1	1	0	1	5	4	0	0	1	0	1	0	0	5	2	0	4	0	1	1
G	0	0	4	0	0	0	2	1	1	0	2	5	0	0	0	0	0	2	0	1
T	3	3	0	0	0	0	0	2	3	5	0	0	4	0	1	0	0	3	3	3

Consensus    
;	consensus.strict             	ttGaCCaatTgGtCcACttt
;	consensus.strict.rc          	AAAGTGGACCAATTGGTCAA
;	consensus.IUPAC              	ttGaCCrwtTrGtCmACktt
;	consensus.IUPAC.rc           	AAMGTKGACYAAWYGGTCAA
;	consensus.regexp             	ttGaCC[ag][at]tT[ag]GtC[ac]AC[gt]tt
;	consensus.regexp.rc          	AA[AC]GT[GT]GAC[CT]AA[AT][CT]GGTCAA

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [AIFS] Automated inference of function from sequence

 [APPH] Assay of protein purified to homogeneity

 [BPP] Binding of purified proteins

 [HIFS] Human inference of function from sequence

 [IDA] Inferred from direct assay

 [IEP] Inferred from expression pattern

 [IMP] Inferred from mutant phenotype

 [APPINH] Assay of protein partially-purified from its native host

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [CV(GEA)] cross validation(GEA)

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [GEA] Gene expression analysis

 [SM] Site mutation


Reference(s)    

 [1] Loh KD., Gyaneshwar P., Markenscoff Papadimitriou E., Fong R., Kim KS., Parales R., Zhou Z., Inwood W., Kustu S., 2006, A previously undescribed pathway for pyrimidine catabolism., Proc Natl Acad Sci U S A 103(13):5114-9

 [2] Perez-Rueda E., Collado-Vides J., Segovia L., 2004, Phylogenetic distribution of DNA-binding transcription factors in bacteria and archaea., Comput Biol Chem 28(5-6):341-50

 [3] Shimada T., Hirao K., Kori A., Yamamoto K., Ishihama A., 2007, RutR is the uracil/thymine-sensing master regulator of a set of genes for synthesis and degradation of pyrimidines., Mol Microbiol 66(3):744-57

 [4] Nguyen Ple M., Bervoets I., Maes D., Charlier D., 2010, The protein-DNA contacts in RutR·carAB operator complexes., Nucleic Acids Res 38(18):6286-300

 [5] Nguyen Le Minh P., de Cima S., Bervoets I., Maes D., Rubio V., Charlier D., 2015, Ligand binding specificity of RutR, a member of the TetR family of transcription regulators in Escherichia coli., FEBS Open Bio 5:76-84

 [6] Shimada T., Ishihama A., Busby SJ., Grainger DC., 2008, The Escherichia coli RutR transcription factor binds at targets within genes as well as intergenic regions., Nucleic Acids Res 36(12):3950-5

 [7] Pontrelli S., Fricke RCB., Teoh ST., Lavina WA., Putri SP., Fitz-Gibbon S., Chung M., Pellegrini M., Fukusaki E., Liao JC., 2018, Metabolic repair through emergence of new pathways in Escherichia coli., Nat Chem Biol 14(11):1005-1009


RegulonDB