RegulonDB RegulonDB 10.6.3:Regulon Page
   

MqsA DNA-binding transcriptional repressor

Synonyms: MqsA
Summary:
The antitoxin MqsA belongs to the toxin-antitoxin system MqsR-MqsA, which controls biofilm formation and triggers programmed cell death in E. coli [3]. mqsR is cotranscribed with the downstream gene mqsA, and their respective open reading frames are separated by 1 bp. The toxin MqsR functions as an mRNA interferase, that is, it possesses endoribonuclease activity and cleaves mRNA at the specific sequence GCU, 5' or 3' of the G. Elevated levels of free MqsR result in programmed cell death due to the degradation of mRNA and concomitant inhibition of protein synthesis [3]. The antitoxin MqsA has two functions. It binds and thereby inhibits the endoribonuclease activity of MqsR. In addition it is a DNA-binding protein, as is the case for other bacterial antitoxins. MqsA recognizes two palindromic sites located between the promoter and the start codon of mqsR [3]. Although it was initially reported that binding to these sites is enhanced when MqsR is bound to MqsA [3], it was later shown that binding of MqsR in fact destabilizes the MqsA-DNA complex [6]. Solution [7, 8] and crystal structures [9, 10] of MqsA have been solved. Both MqsR and MqsA are dimeric proteins.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MqsA Functional   [AIFS], [APPHINH] [1], [2], [3]
Evolutionary Family: CxxCG_CxxCG_HTH, MqsR
Connectivity class: Local Regulator
Gene name: mqsA
  Genome position: 3167851-3168246
  Length: 396 bp / 131 aa
Operon name: mqsRA
TU(s) encoding the TF:
Transcription unit        Promoter
null
mqsRp
null
mqsRp2


Regulon       
Regulated gene(s) csgD, csgE, csgF, csgG, cspD, mqsA, mqsR, rpoS
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (1)
activator (1)
repressor (1)
Accessory Factors Involved in Transport (1)
Putative uncharacterized transport protein (1)
Read more >
Regulated operon(s) csgDEFG, cspD, mqsRA, nlpD-rpoS
First gene in the operon(s) csgD, cspD, rpoS, mqsR
Simple and complex regulons ArcA,CRP,Fur,GadX,MqsA,ppGpp
BasR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsB,RstA,ppGpp
CRP,H-NS,MqsA,ppGpp
MqsA
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MqsA,-](4)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MqsA repressor csgDp1 Sigma38, Sigma70 -83.5 -231.5 csgD, csgE, csgF, csgG
aaacttaataAAACCTTAAGGTTAacattttaat
1103421 1103434 [BPP], [GEA], [HIBSCS] [4]
  MqsA repressor cspDp Sigma70 -132.5 -219.0 cspD
atgatagataACTATCATCTATCGTTGGCatcagcgaca
922800 922818 [BPP], [GEA] [1]
  MqsA repressor cspDp Sigma70 101.5 14.0 cspD
gaagcatggaAAAGGGTACTGTTAAGTGGttcaacaatg
922567 922585 [BPP], [GEA] [1]
  MqsA repressor mqsRp Sigma70 42.0 -68.0 mqsR, mqsA
tacatctaacTAACCTTTTAGGTGCtttttcattg
3168605 3168619 [BPP], [HIBSCS], [IHBCE] [3]
  MqsA repressor mqsRp Sigma70 74.0 -36.0 mqsR, mqsA
ttgctgtaatTAACCTTTTAGGTTAtaactaaagt
3168573 3168587 [BPP], [HIBSCS], [IHBCE] [3]
  MqsA repressor rpoSp Sigma70 -147.0 -714.5 rpoS
gaacgttggtCAGACCTTGCAGGTGGgtaatgcttc
2868258 2868273 [BPP], [GEA], [IHBCE], [SM] [5]


Alignment and PSSM for MqsA TFBSs    

Aligned TFBS of MqsA   
  Sequence
  AAGCACCTAAAAGGTTAGTTA
  TATAACCTAAAAGGTTAATTA
  TCAGACCTTGCAGGTGGGTAA
  TAAAACCTTAAGGTTAACATT
  AACCACTTAACAGTACCCTTT
  GCCAACGATAGATGATAGTTA

Position weight matrix (PWM). MqsA matrix-quality result   
A	2	4	2	3	6	0	0	1	3	5	3	5	0	0	2	1	4	1	1	1	4
C	0	2	2	2	0	6	4	0	0	0	2	0	0	0	0	1	1	2	0	0	0
G	1	0	1	1	0	0	1	0	0	1	1	1	5	4	0	1	1	3	0	0	0
T	3	0	1	0	0	0	1	5	3	0	0	0	1	2	4	3	0	0	5	5	2

Consensus   
;	consensus.strict             	tacaACCtaaaaGGttagtta
;	consensus.strict.rc          	TAACTAACCTTTTAGGTTGTA
;	consensus.IUPAC              	wmmmACCtwamaGKwtasttw
;	consensus.IUPAC.rc           	WAASTAWMCTKTWAGGTKKKW
;	consensus.regexp             	[at][ac][ac][ac]ACCt[at]a[ac]aG[GT][at]ta[cg]tt[at]
;	consensus.regexp.rc          	[AT]AA[CG]TA[AT][AC]CT[GT]T[AT]AGGT[GT][GT][GT][AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [AIFS] Automated inference of function from sequence

 [APPHINH] Assay of protein purified to homogeneity from its native host

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [HIBSCS] Human inference based on similarity to consensus sequences

 [IHBCE] Inferred by a human based on computational evidence

 [SM] Site mutation



Reference(s)    

 [1] Kim Y., Wang X., Zhang XS., Grigoriu S., Page R., Peti W., Wood TK., 2010, Escherichia coli toxin/antitoxin pair MqsR/MqsA regulate toxin CspD., Environ Microbiol 12(5):1105-21

 [2] Perez-Rueda E., Collado-Vides J., Segovia L., 2004, Phylogenetic distribution of DNA-binding transcription factors in bacteria and archaea., Comput Biol Chem 28(5-6):341-50

 [3] Yamaguchi Y., Park JH., Inouye M., 2009, MqsR, a crucial regulator for quorum sensing and biofilm formation, is a GCU-specific mRNA interferase in Escherichia coli., J Biol Chem 284(42):28746-53

 [4] Soo VW., Wood TK., 2013, Antitoxin MqsA represses curli formation through the master biofilm regulator CsgD., Sci Rep 3:3186

 [5] Wang X., Kim Y., Hong SH., Ma Q., Brown BL., Pu M., Tarone AM., Benedik MJ., Peti W., Page R., Wood TK., 2011, Antitoxin MqsA helps mediate the bacterial general stress response., Nat Chem Biol 7(6):359-66

 [6] Brown BL, Lord DM, Grigoriu S, Peti W, Page R, 2013, The Escherichia coli toxin MqsR destabilizes the transcriptional repression complex formed between the antitoxin MqsA and the mqsRA operon promoter., J Biol Chem, 2013 Jan 11

 [7] Papadopoulos E, Billeter M, Gräslund A, Vlamis-Gardikas A, 2007, Assignment of (1)H, (13)C, and (15)N resonances of YgiT, a putative DNA interacting protein from E. coli, containing one HTH and two CxxC motifs., Biomol NMR Assign, 2007 Dec

 [8] Papadopoulos E, Collet JF, Vukojevi? V, Billeter M, Holmgren A, Gräslund A, Vlamis-Gardikas A, 2012, Solution structure and biophysical properties of MqsA, a Zn-containing antitoxin from Escherichia coli., Biochim Biophys Acta, 2012 Dec

 [9] Brown BL, Grigoriu S, Kim Y, Arruda JM, Davenport A, Wood TK, Peti W, Page R, 2009, Three dimensional structure of the MqsR:MqsA complex: a novel TA pair comprised of a toxin homologous to RelE and an antitoxin with unique properties., PLoS Pathog, 2009 Dec

 [10] Brown BL, Wood TK, Peti W, Page R, 2011, Structure of the Escherichia coli antitoxin MqsA (YgiT/b3021) bound to its gene promoter reveals extensive domain rearrangements and the specificity of transcriptional regulation., J Biol Chem, 2011 Jan 21

 [11] Yamaguchi Y, Park JH, Inouye M, 2011, Toxin-antitoxin systems in bacteria and archaea., Annu Rev Genet, 2011

 [12] Yamaguchi Y, Inouye M, 2009, mRNA interferases, sequence-specific endoribonucleases from the toxin-antitoxin systems., Prog Mol Biol Transl Sci, 2009

 [13] Inouye M, 2006, The discovery of mRNA interferases: implication in bacterial physiology and application to biotechnology., J Cell Physiol, 2006 Dec



RegulonDB