RegulonDB RegulonDB 10.8:Regulon Page
   

MqsA DNA-binding transcriptional repressor

Synonyms: MqsA
Summary:
The antitoxin MqsA belongs to the toxin-antitoxin system MqsR-MqsA, which controls biofilm formation and triggers programmed cell death in E. coli [3]. mqsR is cotranscribed with the downstream gene mqsA, and their respective open reading frames are separated by 1 bp. Contrary to what was reported by Yamaguchi et al. [3], Fraikin et al. reported that MqsA does not regulate biofilm formation and is not a response to stress [5]. The toxin MqsR functions as an mRNA interferase, that is, it possesses endoribonuclease activity and cleaves mRNA at the specific sequence GCU, 5' or 3' of the G. Elevated levels of free MqsR result in programmed cell death due to the degradation of mRNA and concomitant inhibition of protein synthesis [3]. The antitoxin MqsA has two functions. It binds and thereby inhibits the endoribonuclease activity of MqsR. In addition, it is a DNA-binding protein, as is the case for other bacterial antitoxins.
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MqsA Functional   [AIFS], [APPHINH] [1], [2], [3]
Evolutionary Family: CxxCG_CxxCG_HTH, MqsR
Connectivity class: Local Regulator
Gene name: mqsA
  Genome position: 3167851-3168246
  Length: 396 bp / 131 aa
Operon name: mqsRA
TU(s) encoding the TF:
Transcription unit        Promoter
mqsA
mqsAp1
mqsA
mqsAp2
mqsRA
mqsRp
mqsRA
mqsRp2


Regulon       
Regulated gene(s) csgD, csgE, csgF, csgG, cspD, mqsA, mqsR, rpoS
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (1)
activator (1)
repressor (1)
Accessory Factors Involved in Transport (1)
fimbri, pili (1)
Read more >
Regulated operon(s) csgDEFG, cspD, mqsRA, nlpD-rpoS
First gene in the operon(s) csgD, cspD, mqsR, rpoS
Simple and complex regulons ArcA,CRP,Fur,GadX,MqsA,ppGpp
BasR,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp
CRP,H-NS,MqsA,ppGpp
MqsA
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MqsA,-](4)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MqsA repressor csgDp1 Sigma38, Sigma70 -83.5 -231.5 csgD, csgE, csgF, csgG
aaacttaataAAACCTTAAGGTTAacattttaat
1103421 1103434 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA] [4]
  MqsA repressor cspDp Sigma70 -132.5 -218.5 cspD
atgatagataACTATCATCTATCGTTGGCatcagcgaca
922800 922818 [BPP], [GEA] [1]
  MqsA repressor cspDp Sigma70 101.5 15.5 cspD
gaagcatggaAAAGGGTACTGTTAAGTGGttcaacaatg
922567 922585 [BPP], [GEA] [1]
  MqsA repressor mqsRp Sigma70 42.0 -68.0 mqsR, mqsA
tacatctaacTAACCTTTTAGGTGCtttttcattg
3168605 3168619 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IHBCE] [3], [5]
  MqsA repressor mqsRp Sigma70 74.0 -36.0 mqsR, mqsA
ttgctgtaatTAACCTTTTAGGTTAtaactaaagt
3168573 3168587 [APIORCISFBSCS], [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(GEA/ROMA)], [GEA], [IHBCE] [3], [5]
  MqsA repressor rpoSp Sigma70 -147.0 -714.0 rpoS
gaacgttggtCAGACCTTGCAGGTGGgtaatgcttc
2868258 2868273 [BPP], [CV(CHIP-SV/GEA/ROMA)], [CV(CHIP-SV/SM)], [CV(GEA/ROMA)], [CV(GEA/ROMA/SM)], [GEA], [IHBCE], [SM] [6]


Alignment and PSSM for MqsA TFBSs    

Aligned TFBS of MqsA   
  Sequence
  AAGCACCTAAAAGGTTAGTTA
  TATAACCTAAAAGGTTAATTA
  TCAGACCTTGCAGGTGGGTAA
  TAAAACCTTAAGGTTAACATT
  AACCACTTAACAGTACCCTTT
  GCCAACGATAGATGATAGTTA

Position weight matrix (PWM). MqsA matrix-quality result   
A	2	4	2	3	6	0	0	1	3	5	3	5	0	0	2	1	4	1	1	1	4
C	0	2	2	2	0	6	4	0	0	0	2	0	0	0	0	1	1	2	0	0	0
G	1	0	1	1	0	0	1	0	0	1	1	1	5	4	0	1	1	3	0	0	0
T	3	0	1	0	0	0	1	5	3	0	0	0	1	2	4	3	0	0	5	5	2

Consensus   
;	consensus.strict             	tacaACCtaaaaGGttagtta
;	consensus.strict.rc          	TAACTAACCTTTTAGGTTGTA
;	consensus.IUPAC              	wmmmACCtwamaGKwtasttw
;	consensus.IUPAC.rc           	WAASTAWMCTKTWAGGTKKKW
;	consensus.regexp             	[at][ac][ac][ac]ACCt[at]a[ac]aG[GT][at]ta[cg]tt[at]
;	consensus.regexp.rc          	[AT]AA[CG]TA[AT][AC]CT[GT]T[AT]AGGT[GT][GT][GT][AT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation






RegulonDB