RegulonDB RegulonDB 10.8:Regulon Page
   

GlrR DNA-binding transcriptional activator

Synonyms: GlrR, GlrR-Pasp56
Summary:
GlrR is the response regulator of the two-component GlrKR signal transduction system, and it has extensive homology to the NtrC family of activators [1] GlrR contains a σ54 interaction domain which binds to a DNA region located more than 100bp upstream of glmY. Transcription of a glmY-lacZ fusion from the σ54 promoter is abolished in a GlrR null strain. Purified GlrR can be phosphorylated in vitro by the cognate histidine kinase GlrK as well as by the non-cognate histidine kinases UhpB, RstB, and BaeS [3]. GlrR: "glmY-regulating response regulator" [1]


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GlrR Non-Functional   Apo [BPP], [GEA], [IDA], [IEP] [1]
GlrR-Pasp56 Functional Covalent Holo [BPP], [GEA], [IDA], [IEP] [1]
Evolutionary Family: EBP
Connectivity class: Local Regulator
Gene name: glrR
  Genome position: 2687469-2688803
  Length: 1335 bp / 444 aa
Operon name: glrR-glnB
TU(s) encoding the TF:
Transcription unit        Promoter
glrR-glnB
 
yfhA
 


Regulon       
Regulated gene(s) glmY, rpoE, rseA, rseB, rseC, rseD
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (4)
sigma factors, anti-sigmafactors (4)
other (mechanical, nutritional, oxidative stress) (4)
temperature extremes (2)
starvation (2)
Read more >
Regulated operon(s) glmY, rseD-rpoE-rseABC
First gene in the operon(s) glmY, rseD
Simple and complex regulons CRP,GlrR,NtrC,RcsB
GlrR,IHF
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[GlrR,+](2)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  GlrR-Pasp56 activator glmYp1 Sigma54 -221.5 -221.5 glmY
agcttttttgTGTCTGTAAATCACGACAatgggtggtt
 2691553 2691570 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [1]
  GlrR-Pasp56 activator glmYp1 Sigma54 -188.5 -188.5 glmY
tggtttgccgTGTCGCTTTCTGGCGACActtaactcat
 2691520 2691537 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [1]
  GlrR-Pasp56 activator glmYp1 Sigma54 -125.5 -125.5 glmY
tatcttaagtTGTCTCTTTTTAGCGACAcagtggctga
 2691457 2691474 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [1]
  GlrR-Pasp56 activator rpoEp2b Sigma70, Sigma54 -90.5 -265.5 rseD, rpoE, rseA, rseB, rseC
cgtcacatgaATGTTCAGGGAGAGTATTCATtttctttgtt
 2710420 2710440 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2]
  GlrR-Pasp56 activator rpoEp2b Sigma70, Sigma54 -65.5 -240.5 rseD, rpoE, rseA, rseB, rseC
tcattttcttTGTTTAATTTACTAAACAtggtttggtc
 2710396 2710413 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2]
  GlrR-Pasp56 activator rpoEp2b Sigma70, Sigma54 -26.5 -201.5 rseD, rpoE, rseA, rseB, rseC
gcatagcatcATGTTGTGCGGATAAACAcctgctattt
 2710357 2710374 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [2]


Alignment and PSSM for GlrR TFBSs    

Aligned TFBS of GlrR   
  Sequence
  GTGTCGCTAAAAAGAGACAACTT
  GTGTCTGTAAATCACGACAATGG
  GTGTCGCCAGAAAGCGACACGGC
  ATGAATGTTCAGGGAGAGTATTC
  ATGTTTAGTAAATTAAACAAAGA
  GCAGGTGTTTATCCGCACAACAT

Position weight matrix (PWM). GlrR matrix-quality result    
A	2	0	1	1	1	0	1	0	3	3	6	3	2	1	3	1	6	0	5	5	1	1	1
C	0	1	0	0	3	0	2	1	0	1	0	0	2	1	2	1	0	5	0	1	2	0	2
G	4	0	5	1	1	2	3	1	0	1	0	1	1	3	1	4	0	1	0	0	1	3	1
T	0	5	0	4	1	4	0	4	3	1	0	2	1	1	0	0	0	0	1	0	2	2	2

Consensus    
;	consensus.strict             	GtGtctgtaaAacgaGACaacgc
;	consensus.strict.rc          	GCGTTGTCTCGTTTTACAGACAC
;	consensus.IUPAC              	RtGtckstwaAwmgmGACaayky
;	consensus.IUPAC.rc           	RMRTTGTCKCKWTTWASMGACAY
;	consensus.regexp             	[AG]tGtc[gt][cg]t[at]aA[at][ac]g[ac]GACaa[ct][gt][ct]
;	consensus.regexp.rc          	[AG][AC][AG]TTGTC[GT]C[GT][AT]TT[AT]A[CG][AC]GACA[CT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [IDA] Inferred from direct assay

 [IEP] Inferred from expression pattern

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [CV(GEA)] cross validation(GEA)

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [SM] Site mutation


Reference(s)    

 [1] Reichenbach B., Gopel Y., Gorke B., 2009, Dual control by perfectly overlapping sigma 54- and sigma 70- promoters adjusts small RNA GlmY expression to different environmental signals., Mol Microbiol 74(5):1054-70

 [2] Klein G., Stupak A., Biernacka D., Wojtkiewicz P., Lindner B., Raina S., 2016, Multiple Transcriptional Factors Regulate Transcription of the rpoE Gene in Escherichia coli under Different Growth Conditions and When the Lipopolysaccharide Biosynthesis Is Defective., J Biol Chem 291(44):22999-23019

 [3] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56


RegulonDB