RegulonDB RegulonDB 10.10:Regulon Page

GlrR DNA-binding transcriptional activator

Synonyms: GlrR-phosphorylated, GlrR
GlrR is the response regulator of the two-component GlrKR signal transduction system, and it has extensive homology to the NtrC family of activators [1] GlrR contains a σ54 interaction domain which binds to a DNA region located more than 100bp upstream of glmY. Transcription of a glmY-lacZ fusion from the σ54 promoter is abolished in a GlrR null strain. Purified GlrR can be phosphorylated in vitro by the cognate histidine kinase GlrK as well as by the non-cognate histidine kinases UhpB, RstB, and BaeS [3]. GlrR: "glmY-regulating response regulator" [1]

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
GlrR Non-Functional   Apo [BPP], [GEA], [IDA], [IEP] [1]
GlrR-phosphorylated Functional Covalent Holo [BPP], [GEA], [IDA], [IEP] [1]
Evolutionary Family: EBP
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: glrR
  Genome position: 2687469-2688803
  Length: 1335 bp / 444 aa
Operon name: glrR-glnB
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) glmY, rpoE, rseA, rseB, rseC, rseD
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (4)
sigma factors, anti-sigmafactors (4)
other (mechanical, nutritional, oxidative stress) (4)
temperature extremes (2)
starvation (2)
Read more >
Regulated operon(s) glmY, rseD-rpoE-rseABC
First gene in the operon(s) glmY, rseD
Simple and complex regulons CRP,GlrR,NtrC,RcsB
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  GlrR-phosphorylated activator glmYp1 Sigma54 -221.5 -221.5 glmY
2691553 2691570 [GEA], [APIORCISFBSCS], [BPP], [SM] [1]
  GlrR-phosphorylated activator glmYp1 Sigma54 -188.5 -188.5 glmY
2691520 2691537 [GEA], [APIORCISFBSCS], [BPP], [SM] [1]
  GlrR-phosphorylated activator glmYp1 Sigma54 -125.5 -125.5 glmY
2691457 2691474 [GEA], [APIORCISFBSCS], [BPP], [SM] [1]
  GlrR-phosphorylated activator rpoEp2b Sigma70 -90.5 -265.5 rseD, rpoE, rseA, rseB, rseC
2710420 2710440 [GEA], [APIORCISFBSCS], [BPP] [2]
  GlrR-phosphorylated activator rpoEp2b Sigma70 -65.5 -240.5 rseD, rpoE, rseA, rseB, rseC
2710396 2710413 [GEA], [APIORCISFBSCS], [BPP] [2]
  GlrR-phosphorylated activator rpoEp2b Sigma70 -26.5 -201.5 rseD, rpoE, rseA, rseB, rseC
2710357 2710374 [GEA], [APIORCISFBSCS], [BPP] [2]
  GlrR-phosphorylated activator rseDp Sigma54 -90.5 -265.5 rseD, rpoE, rseA, rseB, rseC
2710420 2710440 [GEA], [APIORCISFBSCS], [BPP] [2]
  GlrR-phosphorylated activator rseDp Sigma54 -65.5 -240.5 rseD, rpoE, rseA, rseB, rseC
2710396 2710413 [GEA], [APIORCISFBSCS], [BPP] [2]
  GlrR-phosphorylated activator rseDp Sigma54 -26.5 -201.5 rseD, rpoE, rseA, rseB, rseC
2710357 2710374 [GEA], [APIORCISFBSCS], [BPP] [2]

Alignment and PSSM for GlrR TFBSs    

Aligned TFBS of GlrR   

Position weight matrix (PWM). GlrR matrix-quality result   
A	2	0	1	1	1	0	1	0	3	3	6	3	2	1	3	1	6	0	5	5	1	1	1
C	0	1	0	0	3	0	2	1	0	1	0	0	2	1	2	1	0	5	0	1	2	0	2
G	4	0	5	1	1	2	3	1	0	1	0	1	1	3	1	4	0	1	0	0	1	3	1
T	0	5	0	4	1	4	0	4	3	1	0	2	1	1	0	0	0	0	1	0	2	2	2

;	consensus.strict             	GtGtctgtaaAacgaGACaacgc
;	consensus.strict.rc          	GCGTTGTCTCGTTTTACAGACAC
;	consensus.IUPAC              	RtGtckstwaAwmgmGACaayky
;	consensus.regexp             	[AG]tGtc[gt][cg]t[at]aA[at][ac]g[ac]GACaa[ct][gt][ct]
;	consensus.regexp.rc          	[AG][AC][AG]TTGTC[GT]C[GT][AT]TT[AT]A[CG][AC]GACA[CT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation
