RegulonDB RegulonDB 9.3:Regulon Page
   

MlrA DNA-binding transcriptional activator

Synonyms: MlrA
Summary:
MlrA is a regulator of curli production in an avian pathogenic Escherichia coli strain and in Salmonella enterica serovar Typhimurium |CITS: [11489123]|. Shiga toxin-encoding prophages have been observed to integrate at the mlrA gene of enterohemorrhagic E. coli |CITS: [11111050]|.
MlrA is a member of the MerR family, containing the conserved N-terminal DNA-binding domain present in members of this family |CITS: [11489123][20874755]|. On the other hand, its C-terminal domain, probably used by a yet-to-be-identified effector, showed no similarity to any of the hitherto-characterized MerR family members |CITS: [20874755]|.
MlrA binds an AAAGTTGTACA(12N)TGCACAATTTT palindromic sequence and probably induces DNA underwinding, as in the case of MerR |CITS: [20874755]|. Based on the site identified on the csgDp1 promoter, sites for another four genes were identified, two of which are transcriptional regulators |CITS: [20874755]|. MlrA is found at a higher level in the hierarchy of the transcription factor network |CITS: [20874755][20491932]|.
Expression of the mlrA gene is RpoS-regulated in an avian pathogenic E. coli strain |CITS: [11489123]|.
MlrA is part of a signaling cascade that controls curli biosynthesis, in which c-di-GMP regulates through the diguanylate cyclase/phosphodiesterase (DGC/PDE) pair YegH/YhjH (module I) and the activity of the YdaM/YciR pair (module II), which forms a signaling complex with MlrA. Gmr functions as a connector and a trigger enzyme in local c-di-GMP signaling; its direct inhibition of YdaM is relieved when it binds and degrades c-di-GMP, allowing YdaM to activate the transcription factor MlrA |CITS: [23708798]|.
MlrA: MerR-like regulator A |CITS: [11489123]|
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
MlrA     nd nd
Evolutionary Family: MerR
Connectivity class: Local Regulator
Gene name: mlrA
  Genome position: 2214866-2215597
  Length: 732 bp / 243 aa
Operon name: mlrA
TU(s) encoding the TF:
Transcription unit        Promoter
mlrA
mlrAp


Regulon       
Regulated gene(s) cadC, csgD, csgE, csgF, csgG, ibaG, obgE, rplU, rpmA, yhbE
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (2)
activator (2)
membrane (2)
translation (2)
ribosomal proteins (2)
Read more >
Regulated operon(s) cadC, csgDEFG, ibaG-murA, rplU-rpmA-yhbE-obgE
First gene in the operon(s) cadC, csgD, ibaG, rplU, rplU
Simple and complex regulons BasR,CRP,CpxR,Cra,CsgD,FliZ,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA
CadC,FNR,H-NS,LeuO,MlrA
MlrA
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[MlrA,+](4)


Transcription factor binding sites (TFBSs) arrangements       

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  MlrA activator cadCp Sigma70 -201.5 -230.5 cadC
agtgctccggACAATTTTCCATGGATTATTTTCTGAACATTTTTctttggcaaa
4362148 4362181 [BPP], [HIBSCS] [1]
  MlrA activator csgDp1 Sigma38 -129.5 -277.5 csgD, csgE, csgF, csgG
atgattttttAAAATTGTGCAATAAAAACCAAATGTACAACTTTtctatcattt
1103457 1103490 [BPP], [GEA] [1]
  MlrA activator ibaGp2 Sigma24 -117.5 -200.5 ibaG
gggtaaacgaCAAAGTGTATACCCTGGCGAAATTGTATAATTTGcctgctgatg
3336987 3337020 [BPP], [HIBSCS] [1]
  MlrA activator rplUp Sigma70 -85.5 -150.5 rplU, rpmA, yhbE, obgE
ttgtactgaaAAAATGGCACAGATAAACGTTACCGTACAAGTTGtgtttttttt
3333585 3333618 [BPP], [HIBSCS] [1]


Alignment and PSSM for MlrA TFBSs    

Aligned TFBS of MlrA   
  Sequence
  AAGTTGTACATTTGGTTTTTATTGCACAATTTT
  AACTTGTACGGTAACGTTTATCTGTGCCATTTT
  AAAGTGTATACCCTGGCGAAATTGTATAATTTG
  CAATTTTCCATGGATTATTTTCTGAACATTTTT

Position weight matrix (PWM).   
A	3	4	2	0	0	0	0	3	0	3	0	0	1	2	0	0	1	0	1	2	2	0	0	0	1	3	0	3	3	0	0	0	0
C	1	0	1	0	0	0	0	1	3	0	1	1	1	0	1	0	1	0	0	0	0	2	0	0	1	0	3	1	0	0	0	0	0
G	0	0	1	1	0	3	0	0	0	1	1	1	1	1	2	2	0	1	0	0	0	0	0	4	0	1	0	0	0	0	0	0	1
T	0	0	0	3	4	1	4	0	1	0	2	2	1	1	1	2	2	3	3	2	2	2	4	0	2	0	1	0	1	4	4	4	3

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


Evidence    

 [BPP] Binding of purified proteins

 [HIBSCS] Human inference based on similarity to consensus sequences

 [GEA] Gene expression analysis



Reference(s)    

 [1] Ogasawara H., Yamamoto K., Ishihama A., 2010, Regulatory role of MlrA in transcription activation of csgD, the master regulator of biofilm formation in Escherichia coli., FEMS Microbiol Lett. 312(2):160-8



RegulonDB