RegulonDB RegulonDB 10.7:Regulon Page
   

BasR DNA-binding transcriptional dual regulator

Synonyms: BasR, BasR-Phosphorylated
Summary:
The transcriptional regulatory protein BasR is part of the two-component BasS/BasR signal transduction system [7] BasS functions as a membrane-associated protein kinase that phosphorylates BasR in response to elevated levels of Fe(III) which can permeabilize the outer membrane and result in cell death [7, 8, 9] Phosphorylation of BasR increases the affinity for its specific DNA binding sites, leading to the transcriptional expression of several genes involved in modification of lipopolysaccharide to prevent excessiveFe(III) binding [5] basR expression is necessary for lipid A modifications when E. coli is grown in low concentrations of Mg2+. These modifications are necessary for the survival of cells exposed to polymyxin B. [10]. Deletion of basR resulted in susceptibility to cell-killing by elevated levels of Fe(III) [9] Deletion of basSR resulted in acid sensitivity during growth at elevated iron concentrations [5] Expression of the arnBCADTEF operon increased during growth with elevated FeSO4 or FeCl3 and was dependent upon the BasSR two-component signal transduction system [5] Deletion of basR prevents the FeSO4-, ZnSO4-, and NH4VO3-mediated induction of eptA, arnB, and yibD and results in sensitivity to the cationic agent polymyxin B [4] A basRG53V (constitutive) mutant is resistant to polymyxin B and colistin, sensitive to the anionic agent deoxycholic acid, and expresses eptA, arnB, and yibD at high levels [4] Activation of the BasSR two-component system by Fe3+ results in the post-translational inhibition of |FRAME: G7146-MONOMER "LpxT"| and a near total loss of 1-diphosphate lipid A from the cell surface [11].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
BasR Non-Functional   Apo nd nd
BasR-Phosphorylated Functional   Holo nd nd
Evolutionary Family: OmpR
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: basR
  Genome position: 4333282-4333950
  Length: 669 bp / 222 aa
Operon name: basRS
TU(s) encoding the TF:
Transcription unit        Promoter
basRS
 


Regulon       
Regulated gene(s) csgD, csgE, csgF, csgG, cspI, dgkA, fimB, hha, putA, qseB, qseC, tomB, yrbL
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (4)
activator (2)
repressor (2)
fimbri, pili (2)
membrane (2)
Read more >
Regulated operon(s) csgDEFG, cspI, dgkA, fimB, putA, qseBC, tomB-hha, yrbL
First gene in the operon(s) csgD, cspI, dgkA, fimB, putA, qseB, yrbL, tomB
Simple and complex regulons BasR
BasR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp
BasR,CpxR,PdhR
BasR,DksA,DksA-ppGpp,H-NS,IHF,NagC,NanR,ppGpp
BasR,Fis
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[BasR,+](6)
[BasR,-](2)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  BasR-Phosphorylated activator csgDp1 Sigma38, Sigma70 -90.5 -238.5 csgD, csgE, csgF, csgG
tatcatttctAAACTTAATAAAACCTTAAGgttaacattt
1103425 1103444 [APIORCISFBSCS], [BPP], [GEA] [1]
  BasR-Phosphorylated activator cspIp nd -137.5 -282.5 cspI
tccatgagccAAAATTCCTGAAATCTTAAGggtaagataa
1638940 1638959 [APIORCISFBSCS], [BPP] [1]
  BasR-Phosphorylated activator dgkAp1 nd -30.5 -210.5 dgkA
taccaggatgCTTAATGGTAAATTCAGTAAtttgtagtaa
4256417 4256436 [APIORCISFBSCS], [BPP], [GEA], [SM] [2]
  BasR-Phosphorylated activator fimBp2 nd -41.5 -331.5 fimB
ttgaacgaatATTAAATTTTGCTGAATTTTttatgttgat
4540616 4540635 [APIORCISFBSCS], [BPP] [1]
  BasR-Phosphorylated repressor putAp Sigma70 2.5 -41.5 putA
acatcatggaTATTTCACGATAACGTTAAGttgcaccttt
1078914 1078933 [APIORCISFBSCS], [BPP] [1]
  BasR-Phosphorylated activator qseBp2 Sigma70 -13.5 -92.5 qseB, qseC
caagatagtcCTTAACAACTTCTTAAGGGAaaaaaataaa
3169726 3169745 [BPP], [GEA] [3]
  BasR-Phosphorylated activator tomBp1 Sigma70 -394.5 -480.5 tomB, hha
ataacctacgAACATTAAGGAGTAATTGAAccaccaactc
481179 481198 [APIORCISFBSCS], [BPP] [1]
  BasR-Phosphorylated repressor yrbLp nd -52.5 -83.5 yrbL
ctttcagaagAACCTTAAGAAAACCTTAAGaggcattgtt
3348359 3348378 [APIORCISFBSCS], [BPP], [GEA] [1]



High-throughput Transcription factor binding sites (TFBSs)
      

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Growth Condition Evidence (Confirmed, Strong, Weak) References
  BasR-Phosphorylated activator nd nd nd 2365813 2365832 nd [APIORCISFBSCS], [BPP], [GEA] [1], [4], [5], [6]
  BasR-Phosphorylated activator eptA nd nd 4335634 4335653 nd [APIORCISFBSCS], [BPP], [GEA] [1]
  BasR-Phosphorylated activator yibD nd nd 3790127 3790146 nd [APIORCISFBSCS], [GEA] [4]
Other High-throughput regulatory interactions with weak evidence


Alignment and PSSM for BasR TFBSs    

Aligned TFBS of BasR   
  Sequence
  TTAACCTTAAGGTTTTATTAAGT
  TGCCTCTTAAGGTTTTCTTAAGG
  TTACCCTTAAGATTTCAGGAATT
  TTTCCCTTAAGAAGTTGTTAAGG
  CGAACATTAAGGAGTAATTGAAC
  TGCAACTTAACGTTATCGTGAAA
  CGAATATTAAATTTTGCTGAATT
  GGATGCTTAATGGTAAATTCAGT

Position weight matrix (PWM). BasR matrix-quality result   
A	0	0	5	4	1	2	0	0	8	8	1	2	2	0	2	2	4	0	0	5	8	2	1
C	2	0	2	3	4	6	0	0	0	0	1	0	0	0	0	1	3	0	0	1	0	0	1
G	1	5	0	0	1	0	0	0	0	0	5	5	1	2	0	1	1	2	2	2	0	4	2
T	5	3	1	1	2	0	8	8	0	0	1	1	5	6	6	4	0	6	6	0	0	2	4

Consensus   
;	consensus.strict             	tGaccCTTAAGGttttcttaAgt
;	consensus.strict.rc          	ACTTAAGAAAACCTTAAGGGTCA
;	consensus.IUPAC              	yKmmcCTTAAGGtkttmkkrAgk
;	consensus.IUPAC.rc           	MCTYMMKAAMACCTTAAGGKKMR
;	consensus.regexp             	[ct][GT][ac][ac]cCTTAAGGt[gt]tt[ac][gt][gt][ag]Ag[gt]
;	consensus.regexp.rc          	[AC]CT[CT][AC][AC][GT]AA[AC]ACCTTAAGG[GT][GT][AC][AG]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation


Evidence    

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [SM] Site mutation



Reference(s)    

 [1] Ogasawara H., Shinohara S., Yamamoto K., Ishihama A., 2012, Novel regulation targets of the metal-response BasS-BasR two-component system of Escherichia coli., Microbiology 158(Pt 6):1482-92

 [2] Wahl A., My L., Dumoulin R., Sturgis JN., Bouveret E., 2011, Antagonistic regulation of dgkA and plsB genes of phospholipid synthesis by multiple stress responses in Escherichia coli., Mol Microbiol 80(5):1260-75

 [3] Guckes KR., Kostakioti M., Breland EJ., Gu AP., Shaffer CL., Martinez CR., Hultgren SJ., Hadjifrangiskou M., 2013, Strong cross-system interactions drive the activation of the QseB response regulator in the absence of its cognate sensor., Proc Natl Acad Sci U S A 110(41):16592-7

 [4] Froelich JM., Tran K., Wall D., 2006, A pmrA constitutive mutant sensitizes Escherichia coli to deoxycholic acid., J Bacteriol 188(3):1180-3

 [5] Hagiwara D., Yamashino T., Mizuno T., 2004, A Genome-wide view of the Escherichia coli BasS-BasR two-component system implicated in iron-responses., Biosci Biotechnol Biochem 68(8):1758-67

 [6] Lee LJ., Barrett JA., Poole RK., 2005, Genome-wide transcriptional response of chemostat-cultured Escherichia coli to zinc., J Bacteriol 187(3):1124-34

 [7] Nagasawa S., Ishige K., Mizuno T., 1993, Novel members of the two-component signal transduction genes in Escherichia coli., J Biochem 114(3):350-7

 [8] Yamamoto K., Hirao K., Oshima T., Aiba H., Utsumi R., Ishihama A., 2005, Functional characterization in vitro of all two-component signal transduction systems from Escherichia coli., J Biol Chem 280(2):1448-56

 [9] Chamnongpol S, Dodson W, Cromie MJ, Harris ZL, Groisman EA, 2002, Fe(III)-mediated cellular toxicity., Mol Microbiol, 2002 Aug

 [10] Rubin EJ, Herrera CM, Crofts AA, Trent MS, 2015, PmrD is required for modifications to escherichia coli endotoxin that promote antimicrobial resistance., Antimicrob Agents Chemother, 2015 Apr

 [11] Herrera CM., Hankins JV., Trent MS., 2010, Activation of PmrA inhibits LpxT-dependent phosphorylation of lipid A promoting resistance to antimicrobial peptides., Mol Microbiol 76(6):1444-60

 [12] Ho YH, Sung TC, Chen CS, 2012, Lactoferricin B inhibits the phosphorylation of the two-component system response regulators BasR and CreB., Mol Cell Proteomics, 2012 Apr



RegulonDB