![]() ![]() |
Synonyms: BasR, BasR-Phosphorylated |
Summary:
The transcriptional regulatory protein BasR is part of the two-component BasS/BasR signal transduction system [7] BasS functions as a membrane-associated protein kinase that phosphorylates BasR in response to elevated levels of Fe(III) which can permeabilize the outer membrane and result in cell death [7, 8] Phosphorylation of BasR increases the affinity for its specific DNA binding sites, leading to the transcriptional expression of several genes involved in modification of lipopolysaccharide to prevent excessiveFe(III) binding [5] basR expression is necessary for lipid A modifications when E. coli is grown in low concentrations of Mg2+. These modifications are necessary for the survival of cells exposed to polymyxin B. [9]. Deletion of basR resulted in susceptibility to cell-killing by elevated levels of Fe(III) [] Deletion of basSR resulted in acid sensitivity during growth at elevated iron concentrations [5] Expression of the arnBCADTEF operon increased during growth with elevated FeSO4 or FeCl3 and was dependent upon the BasSR two-component signal transduction system [5] Deletion of basR prevents the FeSO4-, ZnSO4-, and NH4VO3-mediated induction of eptA, arnB, and yibD and results in sensitivity to the cationic agent polymyxin B [4] A basRG53V (constitutive) mutant is resistant to polymyxin B and colistin, sensitive to the anionic agent deoxycholic acid, and expresses eptA, arnB, and yibD at high levels [4] Activation of the BasSR two-component system by Fe3+ results in the post-translational inhibition of |FRAME: G7146-MONOMER "LpxT"| and a near total loss of 1-diphosphate lipid A from the cell surface [10]. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | OmpR | ||||||||||||||||||
Sensing class: | External-Two-component systems | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | basR | ||||||||||||||||||
Genome position: | 4333282-4333950 | ||||||||||||||||||
Length: | 669 bp / 222 aa | ||||||||||||||||||
Operon name: | basRS | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | csgD, csgE, csgF, csgG, cspI, dgkA, fimB, hha, putA, qseB, qseC, tomB, yrbL | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
Transcription related (4)
activator (2)
repressor (2)
fimbri, pili (2)
membrane (2)
Read more >
|
||||||
Regulated operon(s) | csgDEFG, cspI, dgkA, fimB, putA, qseBC, tomB-hha, yrbL | ||||||
First gene in the operon(s) | csgD, cspI, dgkA, fimB, putA, qseB, tomB, yrbL | ||||||
Simple and complex regulons | BasR BasR,BtsR,CRP,CpxR,Cra,CsgD,FliZ,H-NS,IHF,MlrA,MqsA,OmpR,RcdA,RcsAB,RstA,ppGpp BasR,CpxR,PdhR BasR,DksA,DksA-ppGpp,H-NS,IHF,NagC,NanR,ppGpp BasR,Fis Read more > | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
BasR-Phosphorylated | activator | csgDp1 | Sigma38, Sigma70 | -90.5 | -238.5 | csgD, csgE, csgF, csgG |
tatcatttctAAACTTAATAAAACCTTAAGgttaacattt
|
1103425 | 1103444 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [1] | |
BasR-Phosphorylated | activator | cspIp | nd | -137.5 | -282.5 | cspI |
tccatgagccAAAATTCCTGAAATCTTAAGggtaagataa
|
1638940 | 1638959 | [APIORCISFBSCS], [BPP] | [1] | |
BasR-Phosphorylated | activator | dgkAp1 | nd | -30.5 | -210.5 | dgkA |
taccaggatgCTTAATGGTAAATTCAGTAAtttgtagtaa
|
4256417 | 4256436 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] | [2] | |
BasR-Phosphorylated | activator | fimBp2 | nd | -41.5 | -331.5 | fimB |
ttgaacgaatATTAAATTTTGCTGAATTTTttatgttgat
|
4540616 | 4540635 | [APIORCISFBSCS], [BPP] | [1] | |
BasR-Phosphorylated | repressor | putAp | Sigma70 | 2.5 | -41.5 | putA |
acatcatggaTATTTCACGATAACGTTAAGttgcaccttt
|
1078914 | 1078933 | [APIORCISFBSCS], [BPP] | [1] | |
BasR-Phosphorylated | activator | qseBp2 | Sigma70 | -13.5 | -92.5 | qseB, qseC |
caagatagtcCTTAACAACTTCTTAAGGGAaaaaaataaa
|
3169726 | 3169745 | [BPP], [GEA] | [3] | |
BasR-Phosphorylated | activator | tomBp1 | Sigma70 | -394.5 | -480.5 | tomB, hha |
ataacctacgAACATTAAGGAGTAATTGAAccaccaactc
|
481179 | 481198 | [APIORCISFBSCS], [BPP] | [1] | |
BasR-Phosphorylated | repressor | yrbLp | nd | -52.5 | -83.5 | yrbL |
ctttcagaagAACCTTAAGAAAACCTTAAGaggcattgtt
|
3348359 | 3348378 | [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] | [1] |
Functional conformation | Function | Object name | Object type | Distance to first Gene | Sequence | LeftPos | RightPos | Center Position | Growth Condition | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
BasR-Phosphorylated | activator | nd | tu | nd |
atattagtttCTTAAGGTTAAGTTAATATTctatccttaa
|
2365813 | 2365832 | 2365822.5 | nd | [APIORCISFBSCS], [BPP], [GEA] | [1], [4], [5], [6] | |
BasR-Phosphorylated | activator | eptA | tu | nd |
accttaagaaCTTAAGGTTGGCTTAATTTTgctttgcgag
|
4335634 | 4335653 | 4335643.5 | nd | [APIORCISFBSCS], [BPP], [GEA] | [1] | |
BasR-Phosphorylated | activator | yibD | tu | nd |
atctcacaggCTTAATAGTTTCTTAATACAaagcctgtaa
|
3790127 | 3790146 | 3790136.5 | nd | [APIORCISFBSCS], [GEA] | [4] |
Alignment and PSSM for BasR TFBSs | ![]() |
---|
Aligned TFBS of BasR |
---|
Sequence | |
---|---|
TTAACCTTAAGGTTTTATTAAGT | |
TGCCTCTTAAGGTTTTCTTAAGG | |
TTACCCTTAAGATTTCAGGAATT | |
TTTCCCTTAAGAAGTTGTTAAGG | |
CGAACATTAAGGAGTAATTGAAC | |
TGCAACTTAACGTTATCGTGAAA | |
CGAATATTAAATTTTGCTGAATT | |
GGATGCTTAATGGTAAATTCAGT |
Position weight matrix (PWM). BasR matrix-quality result |
---|
A 0 0 5 4 1 2 0 0 8 8 1 2 2 0 2 2 4 0 0 5 8 2 1 C 2 0 2 3 4 6 0 0 0 0 1 0 0 0 0 1 3 0 0 1 0 0 1 G 1 5 0 0 1 0 0 0 0 0 5 5 1 2 0 1 1 2 2 2 0 4 2 T 5 3 1 1 2 0 8 8 0 0 1 1 5 6 6 4 0 6 6 0 0 2 4 |
Consensus |
---|
; consensus.strict tGaccCTTAAGGttttcttaAgt ; consensus.strict.rc ACTTAAGAAAACCTTAAGGGTCA ; consensus.IUPAC yKmmcCTTAAGGtkttmkkrAgk ; consensus.IUPAC.rc MCTYMMKAAMACCTTAAGGKKMR ; consensus.regexp [ct][GT][ac][ac]cCTTAAGGt[gt]tt[ac][gt][gt][ag]Ag[gt] ; consensus.regexp.rc [AC]CT[CT][AC][AC][GT]AA[AC]ACCTTAAGG[GT][GT][AC][AG] |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|