![]() ![]() |
Synonyms: PuuR, PuuR-putrescine |
Summary:
PuuR is a transcription repressor that regulates transcription of several genes and operons involved in putrescine utilization and transport [1, 5] Transcription of puuA was induced in a puuR deletion mutant [3]. This regulator is comprised of two domains: the carboxy-terminal domain, which is similar to cupin superfamily proteins, and the amino-terminal domain, which has high similarity to regulators of the HTH-XRE family [5] Nemoto et al. showed that this regulator binds to four target sites in the divergent region located between the operons puuA and puuDR. Its regulator represses transcription by overlapping the promoters puuAp and puuDp, and the binding targets for PuuR consist of 15 nucleotides, with the following recognition sequence: AAAATATAATGAACA [5] The transcription of the puu genes occurs when putrescine interacts with PuuR; this effect changes the conformation of PuuR, and its regulator dissociates from the binding sites. Read more > |
Transcription factor | ![]() ![]() |
||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
TF conformation(s): |
|
||||||||||||||||||
Evolutionary Family: | HTH_3 | ||||||||||||||||||
Connectivity class: | Local Regulator | ||||||||||||||||||
Gene name: | puuR | ||||||||||||||||||
Genome position: | 1361911-1362468 | ||||||||||||||||||
Length: | 558 bp / 185 aa | ||||||||||||||||||
Operon name: | puuDRCBE | ||||||||||||||||||
TU(s) encoding the TF: |
|
Regulon |
![]() ![]() |
||||||
---|---|---|---|---|---|---|---|
Regulated gene(s) | puuA, puuB, puuC, puuD, puuE, puuP, puuR, ymjE | ||||||
Multifun term(s) of regulated gene(s) |
MultiFun Term (List of genes associated to the multifun term)
amines (5)
Porters (Uni-, Sym- and Antiporters) (1)
membrane (1)
transcriptional level (1)
|
||||||
Regulated operon(s) | puuA-ymjE-puuP, puuDRCBE | ||||||
First gene in the operon(s) | puuA, puuD | ||||||
Simple and complex regulons | ArcA,CRP,PuuR ArcA,FNR,PuuR | ||||||
Simple and complex regulatory phrases | Regulatory phrase (List of promoters regulated by the phrase) |
Transcription factor regulation |
![]() |
---|
Functional conformation | Function | Promoter | Sigma factor | Central Rel-Pos | Distance to first Gene | Genes | Sequence | LeftPos | RightPos | Evidence (Confirmed, Strong, Weak) | References | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
PuuR | repressor | puuAp | Sigma38 | -161.5 | -221.5 | puuA, ymjE, puuP |
gataaccggaTTGTTCATTATATTTTCCATgctcaatctc
|
1361120 | 1361139 | [BPP], [CV(GEA)], [CV(GEA)], [GEA], [IC] | [3], [4], [5] | |
PuuR | repressor | puuAp | Sigma38 | -126.5 | -186.5 | puuA, ymjE, puuP |
atctcacaaaGTGGACTAAATTATCGCCATtactgcgctt
|
1361085 | 1361104 | [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [IC], [SM] | [3], [4], [5] | |
PuuR | repressor | puuAp | Sigma38 | -84.5 | -144.5 | puuA, ymjE, puuP |
aatgacctttATGTTCAATATTTTTTCAATctagcagtgg
|
1361043 | 1361062 | [BPP], [CV(GEA)], [CV(GEA)], [GEA], [IC] | [3], [4], [5] | |
PuuR | repressor | puuAp | Sigma38 | 11.5 | -49.5 | puuA, ymjE, puuP |
gattcgaatgGTGGTCATTATATTTTACGCtttgataacg
|
1360948 | 1360967 | [BPP], [CV(GEA)], [CV(GEA)], [GEA], [IC] | [3], [4], [5] | |
PuuR | repressor | puuDp | Sigma38 | -94.5 | -162.5 | puuD, puuR, puuC, puuB, puuE |
cgttatcaaaGCGTAAAATATAATGACCACcattcgaatc
|
1360948 | 1360967 | [BPP], [CV(GEA)], [CV(GEA)], [GEA], [IC] | [3], [4], [5] | |
PuuR | repressor | puuDp | Sigma38 | 1.5 | -67.5 | puuD, puuR, puuC, puuB, puuE |
ccactgctagATTGAAAAAATATTGAACATaaaggtcatt
|
1361043 | 1361062 | [BPP], [CV(GEA)], [CV(GEA)], [GEA], [IC] | [3], [4], [5] | |
PuuR | repressor | puuDp | Sigma38 | 43.5 | -25.5 | puuD, puuR, puuC, puuB, puuE |
aagcgcagtaATGGCGATAATTTAGTCCACtttgtgagat
|
1361085 | 1361104 | [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [IC], [SM] | [3], [4], [5] | |
PuuR | repressor | puuDp | Sigma38 | 78.5 | 10.5 | puuD, puuR, puuC, puuB, puuE |
gagattgagcATGGAAAATATAATGAACAAtccggttatc
|
1361120 | 1361139 | [BPP], [CV(GEA)], [CV(GEA)], [GEA], [IC] | [3], [4], [5] |
Alignment and PSSM for PuuR TFBSs | ![]() |
---|
Aligned TFBS of PuuR |
---|
Sequence | |
---|---|
AGCATGGAAAATATAATGAACA | |
AAAGCGTAAAATATAATGACCA | |
AAAGTGGACTAAATTATCGCCA | |
TAGATTGAAAAAATATTGAACA |
Position weight matrix (PWM). PuuR matrix-quality result |
---|
A 3 3 2 2 0 0 0 4 3 3 4 2 4 0 3 3 0 0 3 2 0 4 C 0 0 1 0 1 0 0 0 1 0 0 0 0 0 0 0 0 1 0 2 4 0 G 0 1 1 2 0 3 3 0 0 0 0 0 0 0 0 0 0 3 1 0 0 0 T 1 0 0 0 3 1 1 0 0 1 0 2 0 4 1 1 4 0 0 0 0 0 |
Consensus |
---|
; consensus.strict aaagtGGAaaAaATaaTGacCA ; consensus.strict.rc TGGTCATTATTTTTTCCACTTT ; consensus.IUPAC arvryGGAmaAwATaaTSrmCA ; consensus.IUPAC.rc TGKYSATTATWTTKTCCRYBYT ; consensus.regexp a[ag][acg][ag][ct]GGA[ac]aA[at]ATaaT[CG][ag][ac]CA ; consensus.regexp.rc TG[GT][CT][CG]ATTAT[AT]TT[GT]TCC[AG][CT][CGT][CT]T |
Evolutionary conservation of regulatory elements | ![]() |
---|
Reference(s) |
![]() |
---|---|