RegulonDB RegulonDB 10.8:Regulon Page

OmpR DNA-binding transcriptional dual regulator

Synonyms: OmpR, OmpR-P

Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
OmpR Functional   Apo nd [1], [2], [3], [4], [5], [6], [7], [8], [9], [10]
OmpR-P Functional Covalent Holo [APPHINH], [HIFS], [IMP] [11], [12], [13]
Sensing class: External-Two-component systems
Connectivity class: Local Regulator
Gene name: ompR
  Genome position: 3535865-3536584
  Length: 720 bp / 239 aa
Operon name: ompR-envZ
TU(s) encoding the TF:
Transcription unit        Promoter

Regulated gene(s) bolA, cadA, cadB, cadC, csgD, csgE, csgF, csgG, dtpA, ecnB, fadL, flhC, flhD, micF, nmpC, ompC, ompF, omrA, omrB, pgaA, pgaB, pgaC, pgaD, sra
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
Transcription related (5)
activator (5)
repressor (4)
Beta barrel porins (The Outer Membrane Porin (OMP) Functional Superfamily) (4)
antisense RNA (4)
Read more >
Regulated operon(s) bdm-sra, bolA, cadBA, cadC, csgDEFG, dtpA, ecnAB, fadL, flhDC, micF, nmpC, ompC, ompF, omrA, omrB, pgaABCD
First gene in the operon(s) bolA, cadB, cadC, csgD, ecnB, fadL, flhD, micF, ompC, ompF, omrA, omrB, pgaA, sra, dtpA
Simple and complex regulons AcrR,CRP,FliZ,Fur,H-NS,HdfR,IHF,LrhA,MatA,OmpR,QseB,RcsAB,YjjQ
Read more >
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)

Transcription factor regulation    

Transcription factor binding sites (TFBSs) arrangements

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence
LeftPos RightPos Growth Conditions Evidence (Confirmed, Strong, Weak) References
  OmpR-P repressor bolAp1 Sigma38, Sigma70 -47.5 -85.5 bolA
454377 454396 nd [APIORCISFBSCS], [BPP] [14]
  OmpR repressor cadBp Sigma70 nd nd cadB, cadA nd nd nd [BPP], [GEA] [15]
  OmpR repressor cadCp Sigma70 nd nd cadC nd nd nd [BPP], [GEA] [15]
  OmpR-P activator csgDp1 Sigma38, Sigma70 -49.5 -197.5 csgD, csgE, csgF, csgG
1103384 1103403 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [16], [17], [18]
  OmpR-P repressor ecnBp Sigma38 18.5 -26.5 ecnB
4376517 4376536 nd [APIORCISFBSCS] [19]
  OmpR-P repressor fadLp Sigma38 -149.5 -250.5 fadL
2461046 2461065 nd [APIORCISFBSCS], [SM] [20], [21]
  OmpR-P repressor fadLp Sigma38 -60.5 -161.5 fadL
2461135 2461154 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [21]
  OmpR-P repressor fadLp Sigma38 69.5 -32.5 fadL
2461264 2461283 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [21]
  OmpR-P repressor fadLp Sigma38 119.5 18.5 fadL
2461314 2461333 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [21]
  OmpR-P repressor flhDp Sigma70 -145.5 -343.5 flhD, flhC
1978531 1978550 nd [APIORCISFBSCS] [22]
  OmpR-P repressor flhDp Sigma70 18.5 -180.5 flhD, flhC
1978368 1978387 nd [APIORCISFBSCS] [22]
  OmpR-P activator micFp Sigma38, Sigma70 -206.5 -206.5 micF
2312868 2312887 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [23], [24], [25], [26]
  OmpR-P activator micFp Sigma38, Sigma70 -186.5 -186.5 micF
2312888 2312907 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [23], [24], [26], [27]
  OmpR-P activator micFp Sigma38, Sigma70 -165.5 -165.5 micF
2312909 2312928 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [23], [24], [26], [27]
  OmpR-P repressor nmpCp nd -45.5 nd nmpC
576906 576925 nd [APIORCISFBSCS], [SM] [28]
  OmpR-P activator ompCp1 Sigma70 -88.5 -169.5 ompC
2312909 2312928 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [23], [24], [26], [27], [29]
  OmpR-P activator ompCp1 Sigma70 -67.5 -148.5 ompC
2312888 2312907 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [23], [24], [26], [27], [29]
  OmpR-P activator ompCp1 Sigma70 -47.5 -128.5 ompC
2312868 2312887 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [23], [24], [25], [26], [29]
  OmpR-P repressor ompFp Sigma38, Sigma70 -370.5 -480.5 ompF
987453 987472 nd [BPP], [GEA] [26], [29], [30], [31], [32]
  OmpR-P activator ompFp Sigma38, Sigma70 -90.5 -200.5 ompF
987173 987192 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [24], [25], [26], [27], [33], [34], [35], [36]
  OmpR-P activator ompFp Sigma38, Sigma70 -70.5 -180.5 ompF
987153 987172 nd [APIORCISFBSCS], [BCE], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [24], [25], [26], [27], [29], [33], [34], [35], [36], [37], [38]
  OmpR-P repressor ompFp Sigma38, Sigma70 -70.5 -180.5 ompF
987153 987172 nd [APIORCISFBSCS], [BCE], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [24], [25], [26], [27], [29], [33], [34], [35], [36], [37], [38]
  OmpR-P activator ompFp Sigma38, Sigma70 -50.5 -160.5 ompF
987133 987152 nd [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [24], [25], [26], [27], [30], [31], [32], [33], [34], [35], [36], [37]
  OmpR-P repressor ompFp Sigma38, Sigma70 -50.5 -160.5 ompF
987133 987152 nd [AIBSCS], [BPP], [CV(GEA)], [CV(GEA)], [CV(GEA/SM)], [CV(SM)], [GEA], [SM] [24], [25], [26], [27], [30], [31], [32], [33], [34], [35], [36], [37]
  OmpR-P activator omrAp nd -70.5 -70.5 omrA
2976250 2976269 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [39]
  OmpR-P activator omrBp nd -71.5 -71.5 omrB
2976447 2976466 nd [APIORCISFBSCS], [CV(GEA)], [GEA] [39]
  OmpR-P repressor pgaAp nd -31.5 -265.5 pgaA, pgaB, pgaC, pgaD
1092545 1092564 nd [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [40]
  OmpR-P repressor srap Sigma38 nd nd sra nd nd nd [GEA] [41]
  OmpR-P activator tppBp Sigma70 -45.5 -143.5 dtpA
1712616 1712635 nd [BPP], [GEA] [42]

High-throughput Transcription factor binding sites (TFBSs)

  Functional conformation Function Object name Object type Distance to first Gene Sequence LeftPos RightPos Center Position Growth Condition Evidence (Confirmed, Strong, Weak) References
  OmpR activator ybaN gene 5.0
490879 490897 490887.0 [1] [43]
  OmpR repressor copA gene -274.0
511645 511663 511653.0 [1] [43]
  OmpR activator ompF gene -159.0
987133 987151 987141.0 [1] [43]
  OmpR activator ompF gene -189.0
987163 987181 987171.0 [1] [43]
  OmpR activator ompF gene -199.0
987173 987191 987181.0 [1] [43]
  OmpR activator ymdF gene -328.0
1067745 1067763 1067753.0 [1] [43]
  OmpR activator narU gene -172.0
1544224 1544242 1544232.0 [1] [43]
  OmpR repressor yobB gene -105.0
1925327 1925345 1925335.0 [1] [43]
  OmpR activator flhD gene -179.0
1978368 1978386 1978376.0 [1] [43]
  OmpR repressor fliA gene -314.0
2002095 2002113 2002103.0 [1] [43]
  OmpR activator ompC gene -127.0
2312868 2312886 2312876.0 [1] [43]
  OmpR activator ompC gene -168.0
2312909 2312927 2312917.0 [1] [43]
  OmpR activator mntH gene -288.0
2512986 2513004 2512994.0 [1] [43]
  OmpR activator nrdF gene -360.0
2803134 2803152 2803142.0 [1] [43]
  OmpR activator queE gene 81.0
2905329 2905347 2905337.0 [1] [43]
  OmpR activator queE gene -105.0
2905515 2905533 2905523.0 [1] [43]
  OmpR activator queE gene -188.0
2905598 2905616 2905606.0 [1] [43]
  OmpR activator queE gene -229.0
2905639 2905657 2905647.0 [1] [43]
  OmpR activator queE gene -269.0
2905679 2905697 2905687.0 [1] [43]
  OmpR repressor alx gene -203.0
3238369 3238387 3238377.0 [1] [43]
  OmpR repressor sraF gene 3.0
3238369 3238387 3238377.0 [1] [43]
  OmpR repressor bfr gene -377.0
3467094 3467112 3467102.0 [1] [43]
  OmpR activator yhiD gene -104.0
3655998 3656016 3656006.0 [1] [43]
  OmpR activator gadE gene -129.0
3658229 3658247 3658237.0 [1] [43]
  OmpR activator yhjE gene -181.0
3674597 3674615 3674605.0 [1] [43]
  OmpR repressor ibpA gene -311.0
3867725 3867743 3867733.0 [1] [43]
  OmpR repressor glmZ gene -51.0
3986373 3986391 3986381.0 [1] [43]
  OmpR repressor soxS gene -210.0
4277585 4277603 4277593.0 [1] [43]
  OmpR repressor ytfJ gene -198.0
4439452 4439470 4439460.0 [1] [43]
  OmpR repressor ytfK gene -127.0
4439452 4439470 4439460.0 [1] [43]
  OmpR activator fecI gene -11.0
4518238 4518256 4518246.0 [1] [43]
  OmpR repressor speF-potE tu nd
nd nd nd nd [BPP], [GEA] [15]
Other High-throughput regulatory interactions with weak evidence

Growth Condition    


C: Escherichia coli str. K-12 substr. MG1655| wild type| M9 minimal medium| sodium chloride 0.3 M; glucose 0.2%| aerobiosis| 37.0 C| mid exponential phase
E: Escherichia coli str. K-12 substr. MG1655| ompR knockout mutant| M9 minimal medium| sodium chloride 0.3 M; glucose 0.2%| aerobiosis| 37.0 C| mid exponential phase

Alignment and PSSM for OmpR TFBSs    

Aligned TFBS of OmpR   

Position weight matrix (PWM). OmpR matrix-quality result   
A	10	12	6	11	3	2	3	14	15	3	6	17	16	15	8	6	4	10	13	8	13	9
C	0	3	5	4	4	0	3	1	0	15	7	0	2	0	2	3	0	0	0	7	3	3
G	3	3	2	4	2	15	1	0	1	0	2	3	2	5	2	7	0	4	0	2	0	2
T	8	3	8	2	12	4	14	6	5	3	6	1	1	1	9	5	17	7	8	4	5	7

;	consensus.strict             	aatatGtaaCcaaatgtaacaa
;	consensus.strict.rc          	TTGTTACATTTGGTTACATATT
;	consensus.IUPAC              	wayatGtaaCcaarwgtwwmaw
;	consensus.IUPAC.rc           	WTKWWACWYTTGGTTACATRTW
;	consensus.regexp             	[at]a[ct]atGtaaCcaa[ag][at]gt[at][at][ac]a[at]
;	consensus.regexp.rc          	[AT]T[GT][AT][AT]AC[AT][CT]TTGGTTACAT[AG]T[AT]

PWM logo   


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
TF-target gene evolutionary conservation
Promoter-target gene evolutionary conservation


 [APPHINH] Assay of protein purified to homogeneity from its native host

 [HIFS] Human inference of function from sequence

 [IMP] Inferred from mutant phenotype

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [GEA] Gene expression analysis

 [CV(GEA)] cross validation(GEA)

 [SM] Site mutation

 [CV(GEA/SM)] cross validation(GEA/SM)

 [CV(SM)] cross validation(SM)

 [BCE] Binding of cellular extracts

 [AIBSCS] Automated inference based on similarity to consensus sequences

 [CE] ChIP-seq evidence


 [1] Comeau DE., Ikenaka K., Tsung KL., Inouye M., 1985, Primary characterization of the protein products of the Escherichia coli ompB locus: structure and regulation of synthesis of the OmpR and EnvZ proteins., J Bacteriol 164(2):578-84

 [2] McBroom AJ., Johnson AP., Vemulapalli S., Kuehn MJ., 2006, Outer membrane vesicle production by Escherichia coli is independent of membrane instability., J Bacteriol 188(15):5385-92

 [3] Nara F., Matsuyama S., Mizuno T., Mizushima S., 1986, Molecular analysis of mutant ompR genes exhibiting different phenotypes as to osmoregulation of the ompF and ompC genes of Escherichia coli., Mol Gen Genet 202(2):194-9

 [4] Pao GM., Saier MH., 1995, Response regulators of bacterial signal transduction systems: selective domain shuffling during evolution., J Mol Evol 40(2):136-54

 [5] Parkinson JS., 1993, Signal transduction schemes of bacteria., Cell 73(5):857-71

 [6] Parkinson JS., Kofoid EC., 1992, Communication modules in bacterial signaling proteins., Annu Rev Genet 26:71-112

 [7] Shuster Y., Steiner-Mordoch S., Alon Cudkowicz N., Schuldiner S., 2016, A Transporter Interactome Is Essential for the Acquisition of Antimicrobial Resistance to Antibiotics., PLoS One 11(4):e0152917

 [8] Stock JB., Stock AM., Mottonen JM., 1990, Signal transduction in bacteria., Nature 344(6265):395-400

 [9] Wurtzel ET., Chou MY., Inouye M., 1982, Osmoregulation of gene expression. I. DNA sequence of the ompR gene of the ompB operon of Escherichia coli and characterization of its gene product., J Biol Chem 257(22):13685-91

 [10] Zhao Z., Eberhart LJ., Orfe LH., Lu SY., Besser TE., Call DR., 2015, Genome-Wide Screening Identifies Six Genes That Are Associated with Susceptibility to Escherichia coli Microcin PDI., Appl Environ Microbiol 81(20):6953-63

 [11] Nixon BT., Ronson CW., Ausubel FM., 1986, Two-component regulatory systems responsive to environmental stimuli share strongly conserved domains with the nitrogen assimilation regulatory genes ntrB and ntrC., Proc Natl Acad Sci U S A 83(20):7850-4

 [12] Norioka S., Ramakrishnan G., Ikenaka K., Inouye M., 1986, Interaction of a transcriptional activator, OmpR, with reciprocally osmoregulated genes, ompF and ompC, of Escherichia coli., J Biol Chem 261(36):17113-9

 [13] Taylor RK., Hall MN., Enquist L., Silhavy TJ., 1981, Identification of OmpR: a positive regulatory protein controlling expression of the major outer membrane matrix porin proteins of Escherichia coli K-12., J Bacteriol 147(1):255-8

 [14] Yamamoto K., Nagura R., Tanabe H., Fujita N., Ishihama A., Utsumi R., 2000, Negative regulation of the bolA1p of Escherichia coli K-12 by the transcription factor OmpR for osmolarity response genes., FEMS Microbiol Lett 186(2):257-62

 [15] Chakraborty S., Winardhi RS., Morgan LK., Yan J., Kenney LJ., 2017, Non-canonical activation of OmpR drives acid and osmotic stress responses in single bacterial cells., Nat Commun 8(1):1587

 [16] Jubelin G., Vianney A., Beloin C., Ghigo JM., Lazzaroni JC., Lejeune P., Dorel C., 2005, CpxR/OmpR interplay regulates curli gene expression in response to osmolarity in Escherichia coli., J Bacteriol 187(6):2038-49

 [17] Ogasawara H., Yamada K., Kori A., Yamamoto K., Ishihama A., 2010, Regulation of the Escherichia coli csgD promoter: interplay between five transcription factors., Microbiology 156(Pt 8):2470-83

 [18] Prigent-Combaret C., Brombacher E., Vidal O., Ambert A., Lejeune P., Landini P., Dorel C., 2001, Complex regulatory network controls initial adhesion and biofilm formation in Escherichia coli via regulation of the csgD gene., J Bacteriol 183(24):7213-23

 [19] Bishop RE., Leskiw BK., Hodges RS., Kay CM., Weiner JH., 1998, The entericidin locus of Escherichia coli and its implications for programmed bacterial cell death., J Mol Biol 280(4):583-96

 [20] Black PN., 1991, Primary sequence of the Escherichia coli fadL gene encoding an outer membrane protein required for long-chain fatty acid transport., J Bacteriol 173(2):435-42

 [21] Higashitani A., Nishimura Y., Hara H., Aiba H., Mizuno T., Horiuchi K., 1993, Osmoregulation of the fatty acid receptor gene fadL in Escherichia coli., Mol Gen Genet 240(3):339-47

 [22] Shin S., Park C., 1995, Modulation of flagellar expression in Escherichia coli by acetyl phosphate and the osmoregulator OmpR., J Bacteriol 177(16):4696-702

 [23] Coyer J., Andersen J., Forst SA., Inouye M., Delihas N., 1990, micF RNA in ompB mutants of Escherichia coli: different pathways regulate micF RNA levels in response to osmolarity and temperature change., J Bacteriol 172(8):4143-50

 [24] Mattison K., Oropeza R., Byers N., Kenney LJ., 2002, A phosphorylation site mutant of OmpR reveals different binding conformations at ompF and ompC., J Mol Biol 315(4):497-511

 [25] Qin L., Yoshida T., Inouye M., 2001, The critical role of DNA in the equilibrium between OmpR and phosphorylated OmpR mediated by EnvZ in Escherichia coli., Proc Natl Acad Sci U S A 98(3):908-13

 [26] Yoshida T., Qin L., Egger LA., Inouye M., 2006, Transcription regulation of ompF and ompC by a single transcription factor, OmpR., J Biol Chem 281(25):17114-23

 [27] Tsung K., Brissette RE., Inouye M., 1989, Identification of the DNA-binding domain of the OmpR protein required for transcriptional activation of the ompF and ompC genes of Escherichia coli by in vivo DNA footprinting., J Biol Chem 264(17):10104-9

 [28] Coll JL., Heyde M., Portalier R., 1994, Expression of the nmpC gene of Escherichia coli K-12 is modulated by external pH. Identification of cis-acting regulatory sequences involved in this regulation., Mol Microbiol 12(1):83-93

 [29] Oshima T., Aiba H., Masuda Y., Kanaya S., Sugiura M., Wanner BL., Mori H., Mizuno T., 2002, Transcriptome analysis of all two-component regulatory system mutants of Escherichia coli K-12., Mol Microbiol 46(1):281-91

 [30] Huang KJ., Schieberl JL., Igo MM., 1994, A distant upstream site involved in the negative regulation of the Escherichia coli ompF gene., J Bacteriol 176(5):1309-15

 [31] Rampersaud A., Harlocker SL., Inouye M., 1994, The OmpR protein of Escherichia coli binds to sites in the ompF promoter region in a hierarchical manner determined by its degree of phosphorylation., J Biol Chem 269(17):12559-66

 [32] Slauch JM., Silhavy TJ., 1991, cis-acting ompF mutations that result in OmpR-dependent constitutive expression., J Bacteriol 173(13):4039-48

 [33] Forst SA., Delgado J., Inouye M., 1989, DNA-binding properties of the transcription activator (OmpR) for the upstream sequences of ompF in Escherichia coli are altered by envZ mutations and medium osmolarity., J Bacteriol 171(6):2949-55

 [34] Lan CY., Igo MM., 1998, Differential expression of the OmpF and OmpC porin proteins in Escherichia coli K-12 depends upon the level of active OmpR., J Bacteriol 180(1):171-4

 [35] Rampersaud A., Norioka S., Inouye M., 1989, Characterization of OmpR binding sequences in the upstream region of the ompF promoter essential for transcriptional activation., J Biol Chem 264(31):18693-700

 [36] Sato M., Machida K., Arikado E., Saito H., Kakegawa T., Kobayashi H., 2000, Expression of outer membrane proteins in Escherichia coli growing at acid pH., Appl Environ Microbiol 66(3):943-7

 [37] Forst S., Kalve I., Durski W., 1995, Molecular analysis of OmpR binding sequences involved in the regulation of ompF in Escherichia coli., FEMS Microbiol Lett 131(2):147-51

 [38] Ramani N., Huang L., Freundlich M., 1992, In vitro interactions of integration host factor with the ompF promoter-regulatory region of Escherichia coli., Mol Gen Genet 231(2):248-55

 [39] Guillier M., Gottesman S., 2006, Remodelling of the Escherichia coli outer membrane by two small regulatory RNAs., Mol Microbiol 59(1):231-47

 [40] Oropeza R., Salgado-Bravo R., Calva E., 2015, Deletion analysis of RcsC reveals a novel signalling pathway controlling poly-N-acetylglucosamine synthesis and biofilm formation in Escherichia coli., Microbiology 161(Pt 4):903-13

 [41] Izutsu K., Wada C., Komine Y., Sako T., Ueguchi C., Nakura S., Wada A., 2001, Escherichia coli ribosome-associated protein SRA, whose copy number increases during stationary phase., J Bacteriol 183(9):2765-73

 [42] Goh EB., Siino DF., Igo MM., 2004, The Escherichia coli tppB (ydgR) gene represents a new class of OmpR-regulated genes., J Bacteriol 186(12):4019-24

 [43] Seo SW, Gao Y, Kim D, Szubin R, Yang J, Cho BK, Palsson BO, 2017, Revealing genome-scale transcriptional regulatory landscape of OmpR highlights its expanded regulatory roles under osmotic stress in Escherichia coli K-12 MG1655., Scientific reports 1:7
