RegulonDB RegulonDB 10.8:Regulon Page
   

HipAB DNA-binding transcriptional repressor

Synonyms: HipAB
Summary:
The transcriptional repressor HipB, for "High persistence," is negatively autoregulated and controls the transcription of a critical persistence factor [4]. hipB foms an operon with hipA, and the products of this operon are classified as a toxin (HipA)-antitoxin (HipB) system. This HipAB system is involved in the high persistence, which is the capacity of the bacteria to survive prolonged exposure to antibiotics [], and Kawano et al. also showed that this system is important for survival during the long-term stationary phase []. The crystal structure of the HipB-HipA-DNA complex has been solved at 2.68 Å resolution []. The complex is tetrameric and is comprised of a HipB homodimer that interacts with DNA, sandwiched by a monomer of HipA on each side [].
Read more >


Transcription factor      
TF conformation(s):
Name Conformation Type TF-Effector Interaction Type Apo/Holo Conformation Evidence (Confirmed, Strong, Weak) References
HipAB Functional   [APPH] [1], [2]
Connectivity class: Local Regulator
Gene name: hipA
  Genome position: 1590854-1592176
  Length: 1323 bp / 440 aa
Operon name: hipBA
TU(s) encoding the TF:
Transcription unit        Promoter
hipBA
hipBp
Gene name: hipB
  Genome position: 1592176-1592442
  Length: 267 bp / 88 aa
Operon name: hipBA
TU(s) encoding the TF:
Transcription unit        Promoter
hipBA
hipBp


Regulon       
Regulated gene(s) hipA, hipB, mazE, mazF, relA
Multifun term(s) of regulated gene(s) MultiFun Term (List of genes associated to the multifun term)
translation (2)
defense/survival (2)
starvation (2)
other (mechanical, nutritional, oxidative stress) (2)
cell killing (2)
Read more >
Regulated operon(s) hipBA, relA-mazEFG
First gene in the operon(s) hipB, relA
Simple and complex regulons HipAB,HipB
HipAB,HipB,IHF
Simple and complex regulatory phrases Regulatory phrase (List of promoters regulated by the phrase)
[HipAB,-](2)


Transcription factor regulation    


Transcription factor binding sites (TFBSs) arrangements
      

  Functional conformation Function Promoter Sigma factor Central Rel-Pos Distance to first Gene Genes Sequence LeftPos RightPos Evidence (Confirmed, Strong, Weak) References
  HipAB repressor hipBp Sigma70 -85.5 -125.5 hipB, hipA
atcctcctttTTATCCGCGATCGCGGATATcgcagcgttt
 1592558 1592577 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1]
  HipAB repressor hipBp Sigma70 -57.5 -97.5 hipB, hipA
atcgcagcgtTTATCCCGTAGAGCGGATAAgatgtgtttc
 1592530 1592549 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1]
  HipAB repressor hipBp Sigma70 -18.5 -58.5 hipB, hipA
tccagattgaCTTATCCTCACTAAAGGATAAaacttataat
 1592491 1592511 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1]
  HipAB repressor hipBp Sigma70 10.5 -30.5 hipB, hipA
aaaacttataATATCCCCTTAAGCGGATAAacttgctgtg
 1592463 1592482 [APIORCISFBSCS], [BPP], [CV(GEA)], [CV(GEA)], [GEA] [1]
  HipAB repressor relAp1 Sigma70 5.0 -174.0 relA, mazE, mazF
tatagtttatGTATCCTGTAACCCTGCAACGCTGGCTCGGGATAgcgaagcgtt
 2913809 2913842 [BPP], [GEA] [3]


Alignment and PSSM for HipAB TFBSs    

Aligned TFBS of HipAB   
  Sequence
  GCGTTTATCCCGTAGAGCGGATAAGATGT
  CTTTTTATCCGCGATCGCGGATATCGCAG
  AGTTTTATCCTTTAGTGAGGATAAGTCAA
  AAGTTTATCCGCTTAAGGGGATATTATAA
  CCTGTAACCCTGCAACGCTGGCTCGGGAT

Position weight matrix (PWM). HipAB matrix-quality result    
A	2	1	0	0	0	1	5	0	0	0	0	0	0	4	2	2	0	1	0	0	4	0	4	2	0	2	0	4	2
C	2	2	0	0	0	0	0	1	5	5	1	2	1	0	0	2	0	3	0	0	0	1	0	1	1	0	2	0	0
G	1	1	2	1	0	0	0	0	0	0	2	2	1	0	2	0	5	1	4	5	1	0	0	0	3	2	1	1	1
T	0	1	3	4	5	4	0	4	0	0	2	1	3	1	1	1	0	0	1	0	0	4	1	2	1	1	2	0	2

Consensus    
;	consensus.strict             	ccttTtAtCCggtagcGcGGataaggcaa
;	consensus.strict.rc          	TTGCCTTATCCGCGCTACCGGATAAAAGG
;	consensus.IUPAC              	mcktTtAtCCkstarmGcGGatawgryaw
;	consensus.IUPAC.rc           	WTRYCWTATCCGCKYTASMGGATAAAMGK
;	consensus.regexp             	[ac]c[gt]tTtAtCC[gt][cg]ta[ag][ac]GcGGata[at]g[ag][ct]a[at]
;	consensus.regexp.rc          	[AT]T[AG][CT]C[AT]TATCCGC[GT][CT]TA[CG][AC]GGATAAA[AC]G[GT]

PWM logo   


 


Evolutionary conservation of regulatory elements    
     Note: Evolutionary conservation of regulatory interactions and promoters is limited to gammaproteobacteria.
Promoter-target gene evolutionary conservation


Evidence    

 [APPH] Assay of protein purified to homogeneity

 [APIORCISFBSCS] A person inferred or reviewed a computer inference of sequence function based on similarity to a consensus sequence.

 [BPP] Binding of purified proteins

 [CV(GEA)] cross validation(GEA)

 [GEA] Gene expression analysis


Reference(s)    

 [1] Black DS., Irwin B., Moyed HS., 1994, Autoregulation of hip, an operon that affects lethality due to inhibition of peptidoglycan or DNA synthesis., J Bacteriol 176(13):4081-91

 [2] Li C., Wang Y., Chen G., 2013, Interaction investigations of HipA binding to HipB dimer and HipB dimer + DNA complex: a molecular dynamics simulation study., J Mol Recognit 26(11):556-67

 [3] Lin CY., Awano N., Masuda H., Park JH., Inouye M., 2013, Transcriptional repressor HipB regulates the multiple promoters in Escherichia coli., J Mol Microbiol Biotechnol 23(6):440-7

 [4] Black DS., Kelly AJ., Mardis MJ., Moyed HS., 1991, Structure and organization of hip, an operon that affects lethality due to inhibition of peptidoglycan or DNA synthesis., J Bacteriol 173(18):5732-9


RegulonDB