RegulonDB RegulonDB 10.9: Gene Sequence
zraS gene sequence


Size: 1398        A: 335  T: 304  G: 411  C: 348

Fasta

 

>zraS E. coli K12. Version NC_000913.3 GI:556503834
atgcgttttatgcaacgttctaaagactccttagctaaatggttaagcgcgatcctcccc
gtggtcattgttgggctggtgggattgtttgcggtaactgtgattcgtgattatgggcgg
gcaagcgaggcagaccgccaggcattactggaaaaaggtaatgtgcttatccgcgctctg
gagtcgggaagccgcgtagggatggggatgcgaatgcaccatgtacagcaacaggcgctt
ctggaagagatggcgggacagccgggagtgttgtggttcgcagtcaccgatgcgcagggc
atcattattcttcatagcgaccccgataaggtcgggcgtgcgctctattcgccggatgaa
atgcagaaattaaagccagaggaaaactcccgctggcggctgcttgggaaaacggaaact
acgcctgcacttgaggtctatcgtttgttccagccaatgtcagcgccctggcggcatgga
atgcacaatatgccgcgctgtaacggcaaagctgtgccacaagtagatgcacaacaggct
atttttatcgccgttgatgccagtgatctggttgcaacccagagtggggaaaagcgcaat
accctgattatcctcttcgccctggcgacggtcttgctggcaagcgtattgtcattcttc
tggtatcgccgctatctgcgctcgcgccagcttctacaagatgaaatgaagcgcaaagag
aagctggtggcgctggggcatcttgcggcaggcgttgcccacgaaatccgtaacccactt
tcctcgattaaaggactggcgaaatactttgccgagcgcgcgcctgcagggggagaagcg
catcaactggcgcaggtgatggcgaaagaggccgaccgtttaaaccgcgtggtaagcgag
ttgctggaactggttaagccaacgcatctggctttgcaggcggtggatctcaacacgctg
attaaccactcattacagctggtaagtcaggatgcaaacagccgggagatccagttacgc
tttaccgccaacgacacattaccggaaattcaggccgacccggacaggctgactcaggtc
ctgttgaatctctatctcaatgctattcaggcgattggtcagcatggcgtgattagcgtg
acggccagcgaaagcggcgcgggcgtgaaaatcagcgttaccgacagcggtaagggaatt
gcggcagatcagcttgatgccatcttcactccgtacttcaccactaaagccgaaggcacc
ggattggggctggcggtcgtgcataatattgttgaacaacacggtggtacaattcaggtc
gcaagccaggagggaaaaggctcaacgttcaccctctggcttccggtcaatattacgcgt
aaggacccacaaggatga
              
                            

Download fasta file
RegulonDB