RegulonDB RegulonDB 10.8: Gene Sequence
rodZ gene sequence


Size: 1014        A: 256  T: 205  G: 271  C: 282

Fasta

 

>rodZ E. coli K12. Version NC_000913.3 GI:556503834
atgaatactgaagccacgcacgaccaaaatgaagcacttactaccggcgctcgcctgcgt
aatgctcgcgaacaactaggacttagtcagcaggccgttgccgagcgactttgcctgaag
gtttccacggtacgcgacattgaagaagataaggcacccgccgatcttgcttcaacattc
ctgcgcggatatatccgctcttatgcgcgtctggtacatattccagaagaagaactgctg
ccagggctggaaaagcaggctccacttcgggctgcaaaagttgcgccgatgcagagtttt
tccctcggtaaacgccgcaaaaaacgcgacggctggctgatgaccttcacttggctggtg
ttgtttgtggttatcggcctgagcggtgcctggtggtggcaagaccgcaaagctcagcag
gaagagatcaccactatggccgatcaatcttcggcggaactgagcagtaatagcgagcag
gggcagagtgttccattaaatacgtcgacaactacagacccggctacaacgtccacgccg
ccagcgtctgtggatactaccgcaaccaacacgcaaacacctgccgtaactgcgccagca
ccagctgttgatccgcaacagaatgcggttgtttcgccttcgcaggcaaatgttgatacc
gccgcgaccccggcaccaacggcagcaacaacgccagatggtgctgcgccgttgccaacc
gatcaggctggcgtgaccacgccggtggctgatccgaatgcgctggtgatgaactttact
gccgattgctggctggaggtcactgatgctaccggtaaaaaattgtttagcggtatgcag
cgtaaagacggtaatttgaacttaaccggccaggcaccgtacaaactgaaaattggtgcg
ccagccgcagtacagatccagtatcaagggaaacctgtcgatctgagtcgttttatcaga
actaaccaggttgcgcgtctgaccctcaatgccgaacaatcaccggcgcagtaa
              
                            

Download fasta file
RegulonDB