RegulonDB RegulonDB 10.9: Gene Sequence
aceA gene sequence


Size: 1305        A: 308  T: 275  G: 378  C: 344

Fasta

 

>aceA E. coli K12. Version NC_000913.3 GI:556503834
atgaaaacccgtacacaacaaattgaagaattacagaaagagtggactcaaccgcgttgg
gaaggcattactcgcccatacagtgcggaagatgtggtgaaattacgcggttcagtcaat
cctgaatgcacgctggcgcaactgggcgcagcgaaaatgtggcgtctgctgcacggtgag
tcgaaaaaaggctacatcaacagcctcggcgcactgactggcggtcaggcgctgcaacag
gcgaaagcgggtattgaagcagtctatctgtcgggatggcaggtagcggcggacgctaac
ctggcggccagcatgtatccggatcagtcgctctatccggcaaactcggtgccagctgtg
gtggagcggatcaacaacaccttccgtcgtgccgatcagatccaatggtccgcgggcatt
gagccgggcgatccgcgctatgtcgattacttcctgccgatcgttgccgatgcggaagcc
ggttttggcggtgtcctgaatgcctttgaactgatgaaagcgatgattgaagccggtgca
gcggcagttcacttcgaagatcagctggcgtcagtgaagaaatgcggtcacatgggcggc
aaagttttagtgccaactcaggaagctattcagaaactggtcgcggcgcgtctggcagct
gacgtgacgggcgttccaaccctgctggttgcccgtaccgatgctgatgcggcggatctg
atcacctccgattgcgacccgtatgacagcgaatttattaccggcgagcgtaccagtgaa
ggcttcttccgtactcatgcgggcattgagcaagcgatcagccgtggcctggcgtatgcg
ccatatgctgacctggtctggtgtgaaacctccacgccggatctggaactggcgcgtcgc
tttgcacaagctatccacgcgaaatatccgggcaaactgctggcttataactgctcgccg
tcgttcaactggcagaaaaacctcgacgacaaaactattgccagcttccagcagcagctg
tcggatatgggctacaagttccagttcatcaccctggcaggtatccacagcatgtggttc
aacatgtttgacctggcaaacgcctatgcccagggcgagggtatgaagcactacgttgag
aaagtgcagcagccggaatttgccgccgcgaaagatggctataccttcgtatctcaccag
caggaagtgggtacaggttacttcgataaagtgacgactattattcagggcggcacgtct
tcagtcaccgcgctgaccggctccactgaagaatcgcagttctaa
              
                            

Download fasta file
RegulonDB