RegulonDB RegulonDB 10.9: Gene Sequence
aceE gene sequence


Size: 2664        A: 663  T: 588  G: 716  C: 697

Fasta

 

>aceE E. coli K12. Version NC_000913.3 GI:556503834
atgtcagaacgtttcccaaatgacgtggatccgatcgaaactcgcgactggctccaggcg
atcgaatcggtcatccgtgaagaaggtgttgagcgtgctcagtatctgatcgaccaactg
cttgctgaagcccgcaaaggcggtgtaaacgtagccgcaggcacaggtatcagcaactac
atcaacaccatccccgttgaagaacaaccggagtatccgggtaatctggaactggaacgc
cgtattcgttcagctatccgctggaacgccatcatgacggtgctgcgtgcgtcgaaaaaa
gacctcgaactgggcggccatatggcgtccttccagtcttccgcaaccatttatgatgtg
tgctttaaccacttcttccgtgcacgcaacgagcaggatggcggcgacctggtttacttc
cagggccacatctccccgggcgtgtacgctcgtgctttcctggaaggtcgtctgactcag
gagcagctggataacttccgtcaggaagttcacggcaatggcctctcttcctatccgcac
ccgaaactgatgccggaattctggcagttcccgaccgtatctatgggtctgggtccgatt
ggtgctatttaccaggctaaattcctgaaatatctggaacaccgtggcctgaaagatacc
tctaaacaaaccgtttacgcgttcctcggtgacggtgaaatggacgaaccggaatccaaa
ggtgcgatcaccatcgctacccgtgaaaaactggataacctggtcttcgttatcaactgt
aacctgcagcgtcttgacggcccggtcaccggtaacggcaagatcatcaacgaactggaa
ggcatcttcgaaggtgctggctggaacgtgatcaaagtgatgtggggtagccgttgggat
gaactgctgcgtaaggataccagcggtaaactgatccagctgatgaacgaaaccgttgac
ggcgactaccagaccttcaaatcgaaagatggtgcgtacgttcgtgaacacttcttcggt
aaatatcctgaaaccgcagcactggttgcagactggactgacgagcagatctgggcactg
aaccgtggtggtcacgatccgaagaaaatctacgctgcattcaagaaagcgcaggaaacc
aaaggcaaagcgacagtaatccttgctcataccattaaaggttacggcatgggcgacgcg
gctgaaggtaaaaacatcgcgcaccaggttaagaaaatgaacatggacggtgtgcgtcat
atccgcgaccgtttcaatgtgccggtgtctgatgcagatatcgaaaaactgccgtacatc
accttcccggaaggttctgaagagcatacctatctgcacgctcagcgtcagaaactgcac
ggttatctgccaagccgtcagccgaacttcaccgagaagcttgagctgccgagcctgcaa
gacttcggcgcgctgttggaagagcagagcaaagagatctctaccactatcgctttcgtt
cgtgctctgaacgtgatgctgaagaacaagtcgatcaaagatcgtctggtaccgatcatc
gccgacgaagcgcgtactttcggtatggaaggtctgttccgtcagattggtatttacagc
ccgaacggtcagcagtacaccccgcaggaccgcgagcaggttgcttactataaagaagac
gagaaaggtcagattctgcaggaagggatcaacgagctgggcgcaggttgttcctggctg
gcagcggcgacctcttacagcaccaacaatctgccgatgatcccgttctacatctattac
tcgatgttcggcttccagcgtattggcgatctgtgctgggcggctggcgaccagcaagcg
cgtggcttcctgatcggcggtacttccggtcgtaccaccctgaacggcgaaggtctgcag
cacgaagatggtcacagccacattcagtcgctgactatcccgaactgtatctcttacgac
ccggcttacgcttacgaagttgctgtcatcatgcatgacggtctggagcgtatgtacggt
gaaaaacaagagaacgtttactactacatcactacgctgaacgaaaactaccacatgccg
gcaatgccggaaggtgctgaggaaggtatccgtaaaggtatctacaaactcgaaactatt
gaaggtagcaaaggtaaagttcagctgctcggctccggttctatcctgcgtcacgtccgt
gaagcagctgagatcctggcgaaagattacggcgtaggttctgacgtttatagcgtgacc
tccttcaccgagctggcgcgtgatggtcaggattgtgaacgctggaacatgctgcacccg
ctggaaactccgcgcgttccgtatatcgctcaggtgatgaacgacgctccggcagtggca
tctaccgactatatgaaactgttcgctgagcaggtccgtacttacgtaccggctgacgac
taccgcgtactgggtactgatggcttcggtcgttccgacagccgtgagaacctgcgtcac
cacttcgaagttgatgcttcttatgtcgtggttgcggcgctgggcgaactggctaaacgt
ggcgaaatcgataagaaagtggttgctgacgcaatcgccaaattcaacatcgatgcagat
aaagttaacccgcgtctggcgtaa
              
                            

Download fasta file
RegulonDB