RegulonDB RegulonDB 11.0: Gene Sequence
agp gene sequence


Size: 1242        A: 332  T: 269  G: 338  C: 303

Fasta

 

>agp E. coli K12. Version NC_000913.3 GI:556503834
atgaacaaaacgctaatcgccgcagctgtggcagggatagttttactcgcttcaaacgct
caggcacaaaccgtaccggaaggctatcagctacagcaagtgctcatgatgagccgccat
aacttacgtgcgccgctggcgaacaatggcagtgtgctggagcagtcgacgccgaataaa
tggccagaatgggacgtccccggtgggcaactcaccaccaaaggtggcgtgctcgaagtg
tatatgggccattacatgcgtgaatggctggcagagcaggggatggtgaaatcgggggaa
tgcccgccgccgtacaccgtttatgcctatgccaatagtctgcaacgtaccgttgcgacc
gcacagttctttattaccggcgcattcccggggtgtgatattcctgtgcatcaccaggaa
aaaatgggcactatggacccaacctttaacccggtgatcaccgatgattccgccgcattc
agtgaacaggcggtggcggcaatggagaaagagctcagcaaactccagcttaccgacagc
taccagctactggaaaaaatcgttaactataaagattcccctgcctgtaaagagaaacaa
cagtgttcgctggtggatggcaaaaatacctttagcgccaagtatcaacaagaaccaggt
gtttccgggccgctgaaagtcggcaactcgctggtagatgcgtttactttgcaatattac
gaaggttttccgatggatcaggtggcctggggagaaatcaaatctgaccagcagtggaag
gtgttgtcgaagcttaaaaacggctaccaggacagcctgtttacctcaccggaagtggcg
cgcaatgttgcgaaaccgctggtcagttatatcgacaaagctctggtcaccgatcgcacc
agcgcaccgaaaattacagtgttggttgggcacgactccaacattgcctctctgttaacg
gcgctggatttcaaaccgtatcagttgcatgaccagaacgaacgcacgccgattggcggc
aaaatcgttttccagcgttggcatgacagcaaagccaatcgcgatttgatgaaaattgaa
tatgtgtatcagagtgcggaacagttacgtaatgccgatgcgttaaccctgcaggcacct
gcgcagcgtgtgacgctggaattaagcggttgcccgatagacgctgatggtttctgcccg
atggataagtttgatagcgtgttgaatgaagcggtgaaataa
              
                            

Download fasta file
RegulonDB