RegulonDB RegulonDB 10.9: Gene Sequence
aldA gene sequence


Size: 1440        A: 368  T: 338  G: 412  C: 322

Fasta

 

>aldA E. coli K12. Version NC_000913.3 GI:556503834
atgtcagtacccgttcaacatcctatgtatatcgatggacagtttgttacctggcgtgga
gacgcatggattgatgtggtaaaccctgctacagaggctgtcatttcccgcatacccgat
ggtcaggccgaggatgcccgtaaggcaatcgatgcagcagaacgtgcacaaccagaatgg
gaagcgttgcctgctattgaacgcgccagttggttgcgcaaaatctccgccgggatccgc
gaacgcgccagtgaaatcagtgcgctgattgttgaagaagggggcaagatccagcagctg
gctgaagtcgaagtggcttttactgccgactatatcgattacatggcggagtgggcacgg
cgttacgagggcgagattattcaaagcgatcgtccaggagaaaatattcttttgtttaaa
cgtgcgcttggtgtgactaccggcattctgccgtggaacttcccgttcttcctcattgcc
cgcaaaatggctcccgctcttttgaccggtaataccatcgtcattaaacctagtgaattt
acgccaaacaatgcgattgcattcgccaaaatcgtcgatgaaataggccttccgcgcggc
gtgtttaaccttgtactggggcgtggtgaaaccgttgggcaagaactggcgggtaaccca
aaggtcgcaatggtcagtatgacaggcagcgtctctgcaggtgagaagatcatggcgact
gcggcgaaaaacatcaccaaagtgtgtctggaattggggggtaaagcaccagctatcgta
atggacgatgccgatcttgaactggcagtcaaagccatcgttgattcacgcgtcattaat
agtgggcaagtgtgtaactgtgcagaacgtgtttatgtacagaaaggcatttatgatcag
ttcgtcaatcggctgggtgaagcgatgcaggcggttcaatttggtaaccccgctgaacgc
aacgacattgcgatggggccgttgattaacgccgcggcgctggaaagggtcgagcaaaaa
gtggcgcgcgcagtagaagaaggggcgagagtggcgttcggtggcaaagcggtagagggg
aaaggatattattatccgccgacattgctgctggatgttcgccaggaaatgtcgattatg
catgaggaaacctttggcccggtgctgccagttgtcgcatttgacacgctggaagatgct
atctcaatggctaatgacagtgattacggcctgacctcatcaatctatacccaaaatctg
aacgtcgcgatgaaagccattaaagggctgaagtttggtgaaacttacatcaaccgtgaa
aacttcgaagctatgcaaggcttccacgccggatggcgtaaatccggtattggcggcgca
gatggtaaacatggcttgcatgaatatctgcagacccaggtggtttatttacagtcttaa
              
                            

Download fasta file
RegulonDB