RegulonDB RegulonDB 10.9: Gene Sequence
alkB gene sequence


Size: 651        A: 142  T: 166  G: 175  C: 168

Fasta

 

>alkB E. coli K12. Version NC_000913.3 GI:556503834
atgttggatctgtttgccgatgctgaaccgtggcaagagccactggcggctggtgcggta
attttacggcgttttgcttttaacgctgcggagcaactgatccgcgatattaatgacgtt
gccagccagtcgccgtttcgccagatggtcacccccgggggatataccatgtcggtggcg
atgaccaactgtgggcatctgggctggacgacccatcggcaaggttatctctattcgccc
attgatccgcaaacaaataaaccgtggcccgccatgccacagagttttcataatttatgt
caacgtgcggctacggcggcgggctatccagatttccagccagatgcttgtcttatcaac
cgctacgctcctggcgcgaaactgtcgctgcatcaggataaagacgaaccggatctgcgc
gcgccaattgtttctgtttctctgggcttacccgcgatttttcaatttggcggcctgaaa
cgaaatgatccgctcaaacgtttgttgttggaacatggcgatgtggtggtatggggcggt
gaatcgcggctgttttatcacggtattcaaccgttgaaagcggggtttcatccactcacc
atcgactgccgctacaacctgacattccgtcaggcaggtaaaaaagaataa
              
                            

Download fasta file
RegulonDB