RegulonDB RegulonDB 10.8: Gene Sequence
osmE gene sequence


Size: 339        A: 94  T: 77  G: 92  C: 76

Fasta

 

>osmE E. coli K12. Version NC_000913.3 GI:556503834
atgaacaagaatatggcaggaattctgagtgcagcggcggtattaaccatgctggcgggt
tgtacggcttatgatcgtaccaaagaccagtttgtacagcctgtggtgaaagacgtcaaa
aaaggcatgagccgggcgcaggttgcacaaattgcgggtaaaccttcgtctgaagtgagc
atgatccatgctcgcggtacttgccagacctacatcctgggtcaacgtgatggtaaagca
gaaacctactttgtcgcgttagatgataccggacatgtcatcaactccggttatcagacc
tgtgctgaatacgacactgatccacaggctgcgaagtaa
              
                            

Download fasta file
RegulonDB