RegulonDB RegulonDB 10.8: Gene Sequence
apaG gene sequence


Size: 378        A: 92  T: 90  G: 94  C: 102

Fasta

 

>apaG E. coli K12. Version NC_000913.3 GI:556503834
atgatcaattcgccccgagtgtgtattcaggttcaaagcgtctacattgaggctcaatct
tcacctgataatgaacgttacgtttttgcttataccgtaaccatacgcaatctggggcga
gcgccagtgcagttgttggggcgttactggctgatcaccaatggcaatggccgtgaaacc
gaagtccagggcgaaggagtggttggcgtccagccacttatcgcgcctggcgaagagtac
cagtacaccagcggtgcaatcattgaaaccccgctgggcaccatgcagggtcactacgaa
atgatcgatgaaaatggcgtccctttcagcatcgacattcccgtattccgactcgccgtt
cccacactcattcattaa
              
                            

Download fasta file
RegulonDB