RegulonDB RegulonDB 10.9: Gene Sequence
appA gene sequence


Size: 1299        A: 317  T: 282  G: 355  C: 345

Fasta

 

>appA E. coli K12. Version NC_000913.3 GI:556503834
atgaaagcgatcttaatcccatttttatctcttctgattccgttaaccccgcaatctgca
ttcgctcagagtgagccggagctgaagctggaaagtgtggtgattgtcagtcgtcatggt
gtgcgtgctccaaccaaggccacgcaactgatgcaggatgtcaccccagacgcatggcca
acctggccggtaaaactgggttggctgacaccgcgcggtggtgagctaatcgcctatctc
ggacattaccaacgccagcgtctggtagccgacggattgctggcgaaaaagggctgcccg
cagtctggtcaggtcgcgattattgctgatgtcgacgagcgtacccgtaaaacaggcgaa
gccttcgccgccgggctggcacctgactgtgcaataaccgtacatacccaggcagatacg
tccagtcccgatccgttatttaatcctctaaaaactggcgtttgccaactggataacgcg
aacgtgactgacgcgatcctcagcagggcaggagggtcaattgctgactttaccgggcat
cggcaaacggcgtttcgcgaactggaacgggtgcttaattttccgcaatcaaacttgtgc
cttaaacgtgagaaacaggacgaaagctgttcattaacgcaggcattaccatcggaactc
aaggtgagcgccgacaatgtctcattaaccggtgcggtaagcctcgcatcaatgctgacg
gagatatttctcctgcaacaagcacagggaatgccggagccggggtggggaaggatcacc
gattcacaccagtggaacaccttgctaagtttgcataacgcgcaattttatttgctacaa
cgcacgccagaggttgcccgcagccgcgccaccccgttattagatttgatcaagacagcg
ttgacgccccatccaccgcaaaaacaggcgtatggtgtgacattacccacttcagtgctg
tttatcgccggacacgatactaatctggcaaatctcggcggcgcactggagctcaactgg
acgcttcccggtcagccggataacacgccgccaggtggtgaactggtgtttgaacgctgg
cgtcggctaagcgataacagccagtggattcaggtttcgctggtcttccagactttacag
cagatgcgtgataaaacgccgctgtcattaaatacgccgcccggagaggtgaaactgacc
ctggcaggatgtgaagagcgaaatgcgcagggcatgtgttcgttggcaggttttacgcaa
atcgtgaatgaagcacgcataccggcgtgcagtttgtaa
              
                            

Download fasta file
RegulonDB