RegulonDB RegulonDB 10.8: Gene Sequence
araB gene sequence


Size: 1701        A: 350  T: 364  G: 501  C: 486

Fasta

 

>araB E. coli K12. Version NC_000913.3 GI:556503834
atggcgattgcaattggcctcgattttggcagtgattctgtgcgagctttggcggtggac
tgcgctaccggtgaagagatcgccaccagcgtagagtggtatccccgttggcagaaaggg
caattttgtgatgccccgaataaccagttccgtcatcatccgcgtgactacattgagtca
atggaagcggcactgaaaaccgtgcttgcagagcttagcgtcgaacagcgcgcagctgtg
gtcgggattggcgttgacagtaccggctcgacgcccgcaccgattgatgccgacggaaac
gtgctggcgctgcgcccggagtttgccgaaaacccgaacgcgatgttcgtattgtggaaa
gaccacactgcggttgaagaagcggaagagattacccgtttgtgccacgcgccgggcaac
gttgactactcccgctacattggtggtatttattccagcgaatggttctgggcaaaaatc
ctgcatgtgactcgccaggacagcgccgtggcgcaatctgccgcatcgtggattgagctg
tgcgactgggtgccagctctgctttccggtaccacccgcccgcaggatattcgtcgcgga
cgttgcagcgccgggcataaatctctgtggcacgaaagctggggcggcctgccgccagcc
agtttctttgatgagctggacccgatcctcaatcgccatttgccttccccgctgttcact
gacacttggactgccgatattccggtgggcaccttatgcccggaatgggcgcagcgtctc
ggcctgcctgaaagcgtggtgatttccggcggcgcgtttgactgccatatgggcgcagtt
ggcgcaggcgcacagcctaacgcactggtaaaagttatcggtacttccacctgcgacatt
ctgattgccgacaaacagagcgttggcgagcgggcagttaaaggtatttgcggtcaggtt
gatggcagcgtggtgcctggatttatcggtctggaagcaggccaatcggcgtttggtgat
atctacgcctggtttggtcgcgtactcggctggccgctggaacagcttgccgcccagcat
ccggaactgaaaacgcaaatcaacgccagccagaaacaactgcttccggcgctgaccgaa
gcatgggccaaaaatccgtctctggatcacctgccggtggtgctcgactggtttaacggc
cgccgcacaccgaacgctaaccaacgcctgaaaggggtgattaccgatcttaacctcgct
accgacgctccgctgctgttcggcggtttgattgctgccaccgcctttggcgcacgcgca
atcatggagtgctttaccgatcaggggatcgccgttaataacgtgatggcactgggcggc
atcgcgcggaaaaaccaggtcattatgcaggcctgctgcgacgtgctgaatcgcccgctg
caaattgttgcctctgaccagtgctgtgcgctcggtgcggcgatttttgctgccgtcgcc
gcgaaagtgcacgcagacatcccatcagctcagcaaaaaatggccagtgcggtagagaaa
accctgcaaccgtgcagcgagcaggcacaacgctttgaacagctttatcgccgctatcag
caatgggcgatgagcgccgaacaacactatcttccaacttccgccccggcacaggctgcc
caggccgttgcgactctataa
              
                            

Download fasta file
RegulonDB