RegulonDB RegulonDB 10.8: Gene Sequence
araF gene sequence


Size: 990        A: 271  T: 206  G: 282  C: 231

Fasta

 

>araF E. coli K12. Version NC_000913.3 GI:556503834
atgcacaaatttactaaagccctggcagccattggtctggcagccgttatgtcacaatcc
gctatggcggagaacctgaagctcggttttctggtgaagcaaccggaagagccgtggttc
cagaccgaatggaagtttgccgataaagccgggaaggatttagggtttgaggttattaag
attgccgtgccggatggcgaaaaaacattgaacgcgatcgacagcctggctgccagtggc
gcaaaaggtttcgttatttgtactccggaccccaaactcggctctgccatcgtcgcgaaa
gcgcgtggctacgatatgaaagtcattgccgtggatgaccagtttgttaacgccaaaggt
aagccaatggataccgttccgctggtgatgatggcggcgactaaaattggcgaacgtcag
ggccaggaactgtataaagagatgcagaaacgtggctgggatgtcaaagaaagcgcggtg
atggcgattaccgccaacgaactggataccgcccgccgccgtactacgggatctatggat
gcgctgaaagcggccggattcccggaaaaacaaatttatcaggtacctaccaaatctaac
gacatcccgggggcatttgacgctgccaactcaatgctggttcaacatccggaagttaaa
cattggctgatcgtcggtatgaacgacagcaccgtgctgggcggcgtacgcgcgacggaa
ggtcagggctttaaagcggccgatatcatcggcattggcattaacggtgtggatgcggtg
agcgaactgtctaaagcacaggcaaccggcttctacggttccctgctgccaagcccggac
gtacatggctataaatccagcgaaatgctttacaactgggtagcaaaagacgttgaaccg
ccaaaatttaccgaagttaccgacgtggtactgatcacgcgtgacaactttaaagaagaa
ctggagaaaaaaggtttaggcggtaagtaa
              
                            

Download fasta file
RegulonDB