RegulonDB RegulonDB 10.9: Gene Sequence
argB gene sequence


Size: 777        A: 182  T: 164  G: 248  C: 183

Fasta

 

>argB E. coli K12. Version NC_000913.3 GI:556503834
atgatgaatccattaattatcaaactgggcggcgtactgctggatagtgaagaggcgctg
gaacgtctgtttagcgcactggtgaattatcgtgagtcacatcagcgtccgctggtgatt
gtgcacggcggcggttgcgtggtggatgagctgatgaaagggctgaatctgccggtgaaa
aagaaaaacggcctgcgggtgacgcctgctgatcagatagacattatcaccggagcactg
gcgggaacggcaaataaaaccctgttggcatgggcgaagaaacatcagattgcggccgta
ggtttgtttctcggtgacggcgacagcgtcaaagtgacccagcttgatgaagagttaggt
catgttggactggcgcagccaggttcgcctaagcttatcaactccttgctggagaacggt
tatctgccggtggtcagctccattggcgtaacagacgaagggcaactgatgaacgtcaat
gccgaccaggcggcaacggcgctggcggcaacgctgggcgcggatctgattttgctctcc
gacgtcagcggcattctcgacggcaaagggcaacgcattgccgaaatgaccgccgcgaaa
gcagaacaactgattgagcagggcattattactgacggcatgatagtgaaagtgaacgcg
gcgctggatgcggcccgcacgctgggccgtccggtagatatcgcctcctggcgtcatgcg
gagcagcttccggcactgtttaacggtatgccgatgggtacgcggattttagcttaa
              
                            

Download fasta file
RegulonDB