RegulonDB RegulonDB 10.9: Gene Sequence
argT gene sequence


Size: 783        A: 196  T: 194  G: 209  C: 184

Fasta

 

>argT E. coli K12. Version NC_000913.3 GI:556503834
atgaagaagtcgattctcgctctgtctttgttagtcggtctctccacagcggcttccagc
tatgcggcgctaccggagacggtacgtatcggaaccgataccacctacgcaccgttctca
tcgaaagatgctaaaggtgattttgttggctttgatatcgatctcggtaacgagatgtgc
aaacggatgcaggtgaaatgtacctgggttgccagtgactttgacgcgctgatcccctca
ctgaaagcgaaaaaaatcgacgctattatttcgtcgctttccattaccgataaacgtcag
caggagattgccttctccgacaagctgtacgccgcagattctcgtttgattgcggccaaa
ggttcaccgattcagccaacgctggattcactgaaaggtaaacatgttggtgtgctgcag
ggatcaacccaggaagcttacgctaacgagacctggcgtagtaaaggcgtggatgtggtg
gcctatgccaaccaggatttggtctattccgatctggctgcaggacgtctggatgctgcg
ttacaagatgaagttgctgccagcgaaggattcctcaagcaacctgctggtaaagatttc
gcctttgctggctcatcagtaaaagacaaaaaatacttcggtgatggcaccggtgtaggg
ctacgtaaagatgatgctgaactgacggctgccttcaataaggcgcttggcgagctgcgt
caggacggcacctacgacaagatggcgaaaaagtatttcgactttaatgtctacggtgac
tga
              
                            

Download fasta file
RegulonDB